ID: 1020858006

View in Genome Browser
Species Human (GRCh38)
Location 7:13452824-13452846
Sequence TGCACATTTTTACAAACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020858006_1020858008 0 Left 1020858006 7:13452824-13452846 CCAAGAGTTTGTAAAAATGTGCA No data
Right 1020858008 7:13452847-13452869 GATGGAGCCATTTGTAGTTCAGG No data
1020858006_1020858009 1 Left 1020858006 7:13452824-13452846 CCAAGAGTTTGTAAAAATGTGCA No data
Right 1020858009 7:13452848-13452870 ATGGAGCCATTTGTAGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020858006 Original CRISPR TGCACATTTTTACAAACTCT TGG (reversed) Intergenic