ID: 1020858009

View in Genome Browser
Species Human (GRCh38)
Location 7:13452848-13452870
Sequence ATGGAGCCATTTGTAGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020858005_1020858009 2 Left 1020858005 7:13452823-13452845 CCCAAGAGTTTGTAAAAATGTGC No data
Right 1020858009 7:13452848-13452870 ATGGAGCCATTTGTAGTTCAGGG No data
1020858006_1020858009 1 Left 1020858006 7:13452824-13452846 CCAAGAGTTTGTAAAAATGTGCA No data
Right 1020858009 7:13452848-13452870 ATGGAGCCATTTGTAGTTCAGGG No data
1020858003_1020858009 30 Left 1020858003 7:13452795-13452817 CCTGAAGGGGACAACTTTTCAGC No data
Right 1020858009 7:13452848-13452870 ATGGAGCCATTTGTAGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020858009 Original CRISPR ATGGAGCCATTTGTAGTTCA GGG Intergenic