ID: 1020862760

View in Genome Browser
Species Human (GRCh38)
Location 7:13515620-13515642
Sequence AACCACAACAAAAACAATCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020862760_1020862763 1 Left 1020862760 7:13515620-13515642 CCCGGATTGTTTTTGTTGTGGTT No data
Right 1020862763 7:13515644-13515666 TGACTGACCAGCTATAAATCGGG 0: 10
1: 35
2: 79
3: 156
4: 332
1020862760_1020862768 23 Left 1020862760 7:13515620-13515642 CCCGGATTGTTTTTGTTGTGGTT No data
Right 1020862768 7:13515666-13515688 GGTTTCCATGACCCCTCTTGGGG No data
1020862760_1020862764 2 Left 1020862760 7:13515620-13515642 CCCGGATTGTTTTTGTTGTGGTT No data
Right 1020862764 7:13515645-13515667 GACTGACCAGCTATAAATCGGGG 0: 2
1: 17
2: 51
3: 125
4: 225
1020862760_1020862767 22 Left 1020862760 7:13515620-13515642 CCCGGATTGTTTTTGTTGTGGTT No data
Right 1020862767 7:13515665-13515687 GGGTTTCCATGACCCCTCTTGGG No data
1020862760_1020862766 21 Left 1020862760 7:13515620-13515642 CCCGGATTGTTTTTGTTGTGGTT No data
Right 1020862766 7:13515664-13515686 GGGGTTTCCATGACCCCTCTTGG No data
1020862760_1020862762 0 Left 1020862760 7:13515620-13515642 CCCGGATTGTTTTTGTTGTGGTT No data
Right 1020862762 7:13515643-13515665 CTGACTGACCAGCTATAAATCGG 0: 17
1: 29
2: 78
3: 113
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020862760 Original CRISPR AACCACAACAAAAACAATCC GGG (reversed) Intergenic
No off target data available for this crispr