ID: 1020862765

View in Genome Browser
Species Human (GRCh38)
Location 7:13515651-13515673
Sequence TGGAAACCCCGATTTATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020862765_1020862767 -9 Left 1020862765 7:13515651-13515673 CCAGCTATAAATCGGGGTTTCCA No data
Right 1020862767 7:13515665-13515687 GGGTTTCCATGACCCCTCTTGGG No data
1020862765_1020862773 29 Left 1020862765 7:13515651-13515673 CCAGCTATAAATCGGGGTTTCCA No data
Right 1020862773 7:13515703-13515725 TAGAGTCATTCACAGAACTCAGG No data
1020862765_1020862768 -8 Left 1020862765 7:13515651-13515673 CCAGCTATAAATCGGGGTTTCCA No data
Right 1020862768 7:13515666-13515688 GGTTTCCATGACCCCTCTTGGGG No data
1020862765_1020862774 30 Left 1020862765 7:13515651-13515673 CCAGCTATAAATCGGGGTTTCCA No data
Right 1020862774 7:13515704-13515726 AGAGTCATTCACAGAACTCAGGG No data
1020862765_1020862766 -10 Left 1020862765 7:13515651-13515673 CCAGCTATAAATCGGGGTTTCCA No data
Right 1020862766 7:13515664-13515686 GGGGTTTCCATGACCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020862765 Original CRISPR TGGAAACCCCGATTTATAGC TGG (reversed) Intergenic
No off target data available for this crispr