ID: 1020862767

View in Genome Browser
Species Human (GRCh38)
Location 7:13515665-13515687
Sequence GGGTTTCCATGACCCCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020862761_1020862767 21 Left 1020862761 7:13515621-13515643 CCGGATTGTTTTTGTTGTGGTTC No data
Right 1020862767 7:13515665-13515687 GGGTTTCCATGACCCCTCTTGGG No data
1020862765_1020862767 -9 Left 1020862765 7:13515651-13515673 CCAGCTATAAATCGGGGTTTCCA No data
Right 1020862767 7:13515665-13515687 GGGTTTCCATGACCCCTCTTGGG No data
1020862760_1020862767 22 Left 1020862760 7:13515620-13515642 CCCGGATTGTTTTTGTTGTGGTT No data
Right 1020862767 7:13515665-13515687 GGGTTTCCATGACCCCTCTTGGG No data
1020862759_1020862767 23 Left 1020862759 7:13515619-13515641 CCCCGGATTGTTTTTGTTGTGGT No data
Right 1020862767 7:13515665-13515687 GGGTTTCCATGACCCCTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020862767 Original CRISPR GGGTTTCCATGACCCCTCTT GGG Intergenic
No off target data available for this crispr