ID: 1020862871

View in Genome Browser
Species Human (GRCh38)
Location 7:13516419-13516441
Sequence ATTCTTATAATCTCCAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020862871_1020862875 2 Left 1020862871 7:13516419-13516441 CCCGGCCTGGAGATTATAAGAAT No data
Right 1020862875 7:13516444-13516466 TAGAAGTTGTATGACAGGAAAGG No data
1020862871_1020862874 -3 Left 1020862871 7:13516419-13516441 CCCGGCCTGGAGATTATAAGAAT No data
Right 1020862874 7:13516439-13516461 AATCTTAGAAGTTGTATGACAGG No data
1020862871_1020862877 4 Left 1020862871 7:13516419-13516441 CCCGGCCTGGAGATTATAAGAAT No data
Right 1020862877 7:13516446-13516468 GAAGTTGTATGACAGGAAAGGGG No data
1020862871_1020862876 3 Left 1020862871 7:13516419-13516441 CCCGGCCTGGAGATTATAAGAAT No data
Right 1020862876 7:13516445-13516467 AGAAGTTGTATGACAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020862871 Original CRISPR ATTCTTATAATCTCCAGGCC GGG (reversed) Intergenic
No off target data available for this crispr