ID: 1020862875

View in Genome Browser
Species Human (GRCh38)
Location 7:13516444-13516466
Sequence TAGAAGTTGTATGACAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020862870_1020862875 10 Left 1020862870 7:13516411-13516433 CCACAGTGCCCGGCCTGGAGATT No data
Right 1020862875 7:13516444-13516466 TAGAAGTTGTATGACAGGAAAGG No data
1020862871_1020862875 2 Left 1020862871 7:13516419-13516441 CCCGGCCTGGAGATTATAAGAAT No data
Right 1020862875 7:13516444-13516466 TAGAAGTTGTATGACAGGAAAGG No data
1020862873_1020862875 -3 Left 1020862873 7:13516424-13516446 CCTGGAGATTATAAGAATCTTAG No data
Right 1020862875 7:13516444-13516466 TAGAAGTTGTATGACAGGAAAGG No data
1020862872_1020862875 1 Left 1020862872 7:13516420-13516442 CCGGCCTGGAGATTATAAGAATC No data
Right 1020862875 7:13516444-13516466 TAGAAGTTGTATGACAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020862875 Original CRISPR TAGAAGTTGTATGACAGGAA AGG Intergenic
No off target data available for this crispr