ID: 1020870107

View in Genome Browser
Species Human (GRCh38)
Location 7:13618334-13618356
Sequence CTGATTTTTATTCAAGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020870107_1020870109 0 Left 1020870107 7:13618334-13618356 CCTGAGACTTGAATAAAAATCAG No data
Right 1020870109 7:13618357-13618379 TTGAATTCATGTATCAATTTGGG No data
1020870107_1020870110 1 Left 1020870107 7:13618334-13618356 CCTGAGACTTGAATAAAAATCAG No data
Right 1020870110 7:13618358-13618380 TGAATTCATGTATCAATTTGGGG No data
1020870107_1020870108 -1 Left 1020870107 7:13618334-13618356 CCTGAGACTTGAATAAAAATCAG No data
Right 1020870108 7:13618356-13618378 GTTGAATTCATGTATCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020870107 Original CRISPR CTGATTTTTATTCAAGTCTC AGG (reversed) Intergenic
No off target data available for this crispr