ID: 1020873215

View in Genome Browser
Species Human (GRCh38)
Location 7:13660551-13660573
Sequence TGGGATTCCATGTGAATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020873215_1020873222 26 Left 1020873215 7:13660551-13660573 CCTAAAATTCACATGGAATCCCA No data
Right 1020873222 7:13660600-13660622 TTTAAAAAGAACAAAACTGGAGG 0: 2
1: 16
2: 153
3: 1628
4: 9727
1020873215_1020873221 23 Left 1020873215 7:13660551-13660573 CCTAAAATTCACATGGAATCCCA No data
Right 1020873221 7:13660597-13660619 TTCTTTAAAAAGAACAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020873215 Original CRISPR TGGGATTCCATGTGAATTTT AGG (reversed) Intergenic
No off target data available for this crispr