ID: 1020873221

View in Genome Browser
Species Human (GRCh38)
Location 7:13660597-13660619
Sequence TTCTTTAAAAAGAACAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020873215_1020873221 23 Left 1020873215 7:13660551-13660573 CCTAAAATTCACATGGAATCCCA No data
Right 1020873221 7:13660597-13660619 TTCTTTAAAAAGAACAAAACTGG No data
1020873218_1020873221 4 Left 1020873218 7:13660570-13660592 CCCAAGGGACTCCAAATAGCTGA No data
Right 1020873221 7:13660597-13660619 TTCTTTAAAAAGAACAAAACTGG No data
1020873220_1020873221 -7 Left 1020873220 7:13660581-13660603 CCAAATAGCTGAAACATTCTTTA No data
Right 1020873221 7:13660597-13660619 TTCTTTAAAAAGAACAAAACTGG No data
1020873214_1020873221 28 Left 1020873214 7:13660546-13660568 CCTATCCTAAAATTCACATGGAA 0: 8
1: 88
2: 164
3: 295
4: 528
Right 1020873221 7:13660597-13660619 TTCTTTAAAAAGAACAAAACTGG No data
1020873219_1020873221 3 Left 1020873219 7:13660571-13660593 CCAAGGGACTCCAAATAGCTGAA No data
Right 1020873221 7:13660597-13660619 TTCTTTAAAAAGAACAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020873221 Original CRISPR TTCTTTAAAAAGAACAAAAC TGG Intergenic
No off target data available for this crispr