ID: 1020879025

View in Genome Browser
Species Human (GRCh38)
Location 7:13735715-13735737
Sequence CTTATTAAGGCCAACATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020879023_1020879025 0 Left 1020879023 7:13735692-13735714 CCTCAATATGGTACAAAAACTTA No data
Right 1020879025 7:13735715-13735737 CTTATTAAGGCCAACATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020879025 Original CRISPR CTTATTAAGGCCAACATCAA TGG Intergenic
No off target data available for this crispr