ID: 1020882159

View in Genome Browser
Species Human (GRCh38)
Location 7:13775798-13775820
Sequence ATAGGCGTGTTCCTCCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020882156_1020882159 -5 Left 1020882156 7:13775780-13775802 CCATCAAGTAGGTCCTACATAGG No data
Right 1020882159 7:13775798-13775820 ATAGGCGTGTTCCTCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020882159 Original CRISPR ATAGGCGTGTTCCTCCCTGA AGG Intergenic
No off target data available for this crispr