ID: 1020888490

View in Genome Browser
Species Human (GRCh38)
Location 7:13849616-13849638
Sequence TAGGAACCCTGACACCACTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020888488_1020888490 -3 Left 1020888488 7:13849596-13849618 CCAGATCTTGTGGTTAGAGATAG No data
Right 1020888490 7:13849616-13849638 TAGGAACCCTGACACCACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020888490 Original CRISPR TAGGAACCCTGACACCACTG CGG Intergenic