ID: 1020895060

View in Genome Browser
Species Human (GRCh38)
Location 7:13929600-13929622
Sequence CAGTTGTTCGTGAAGGCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020895060_1020895069 29 Left 1020895060 7:13929600-13929622 CCTCATGCCTTCACGAACAACTG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1020895069 7:13929652-13929674 TATATAGGAGCAATGTGCTCTGG No data
1020895060_1020895067 14 Left 1020895060 7:13929600-13929622 CCTCATGCCTTCACGAACAACTG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1020895067 7:13929637-13929659 TTGAACCTAGCACTATATATAGG 0: 1
1: 0
2: 0
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020895060 Original CRISPR CAGTTGTTCGTGAAGGCATG AGG (reversed) Intronic
901105963 1:6756765-6756787 CAGTTGTCTGTGAAGGGATTTGG + Intergenic
903963601 1:27072668-27072690 CAGGTATGGGTGAAGGCATGAGG + Intergenic
905227729 1:36490453-36490475 CAGCTGCTCCTGCAGGCATGGGG + Intergenic
905772148 1:40645313-40645335 CAGTATTTCTGGAAGGCATGTGG + Intronic
906265960 1:44429715-44429737 CAGTTGTTGATGAAGGAGTGGGG + Intronic
907633297 1:56106573-56106595 CAGTTGATGGTGAGGGCAGGTGG + Intergenic
910606198 1:89087463-89087485 CAGTTGCTCCTGCAGGCCTGGGG + Intergenic
912932870 1:113980318-113980340 CAGCCGTTCCTGAAGGGATGGGG - Exonic
919023761 1:192142102-192142124 CAATTTTTGGTGAAGGCCTGGGG + Intergenic
919320279 1:196027780-196027802 CAGGGCTTCATGAAGGCATGGGG - Intergenic
924302507 1:242653487-242653509 CACTTGTTCATTAATGCATGTGG - Intergenic
1065643918 10:27814823-27814845 CAGTTATTGGTGAAGGCACAGGG - Intronic
1068949404 10:62762090-62762112 CAGTGGTCAGTGAAGGCTTGTGG - Intergenic
1069696539 10:70390310-70390332 CAGTTGTTCTAGAAGGCTTGGGG - Intergenic
1075008168 10:118845326-118845348 CAGCTGTTTGTGAATGCATGTGG + Intergenic
1082969317 11:59002938-59002960 CAGCTGCTCCTGAAGACATGGGG - Intronic
1083393981 11:62375768-62375790 CAGCTGCTCCTGCAGGCATGGGG + Intronic
1083741212 11:64712615-64712637 GAGGCGTTCGTGAAGGCTTGTGG - Intronic
1085415103 11:76314473-76314495 CAGGAGTTCCTGAAGGCAGGGGG - Intergenic
1091651093 12:2310648-2310670 TAGTTGTTCCTAAAGGCAGGGGG + Intronic
1092549944 12:9487343-9487365 AAAATGTTAGTGAAGGCATGTGG + Intergenic
1099330280 12:81276182-81276204 CACTTGTAAGTGAAAGCATGAGG - Intronic
1100201660 12:92305391-92305413 CAGTTTTTGGTGAAAGCATGAGG - Intergenic
1107112067 13:36708698-36708720 CATTTGTAAGTGAAGACATGTGG + Intergenic
1107396167 13:40020114-40020136 CAGTTGTTCCCTAGGGCATGGGG - Intergenic
1109602304 13:64647748-64647770 CAGTGGTTGGTGAGGGTATGGGG + Intergenic
1110925086 13:81140929-81140951 CACTTGTTTGTGGAGGCCTGGGG - Intergenic
1117196679 14:53346809-53346831 CAGTTGTCCCTGAGGGCATGGGG + Intergenic
1118346566 14:64945466-64945488 CGGGTCTTCCTGAAGGCATGAGG - Intronic
1123786862 15:23683333-23683355 CAGGTGTTTGTGAAGAAATGAGG + Intergenic
1128145848 15:65332146-65332168 CAGCTGTGAGTGACGGCATGAGG + Intronic
1131654914 15:94445900-94445922 CAGTCGTCCGTGATGGTATGTGG - Intronic
1133303973 16:4798708-4798730 CTGTTGTTCCTTAATGCATGGGG - Intronic
1139114942 16:63938856-63938878 CAGAGGTTAATGAAGGCATGAGG - Intergenic
1141734151 16:85841035-85841057 CAGTGGTTCCCAAAGGCATGCGG + Intergenic
1142844333 17:2660479-2660501 CAGTTATGCGTGAGAGCATGCGG + Intronic
1144829615 17:18123939-18123961 CAGGTGTTCCTGTAGGCCTGTGG - Intronic
1146920090 17:36704353-36704375 CAGATGTCTCTGAAGGCATGGGG + Intergenic
1147488338 17:40840421-40840443 CCTTTGTTCTTGTAGGCATGGGG + Intergenic
1147615427 17:41824566-41824588 CAGATGTTACTGAAGGCCTGCGG - Intergenic
1148662656 17:49347705-49347727 CAATTTTTCTTGCAGGCATGGGG - Intronic
1151103464 17:71583646-71583668 CAGGTCTTTGTGAAGTCATGTGG - Intergenic
1152070956 17:78133400-78133422 TAGGTGTTGGTGAAGGCCTGGGG - Exonic
1156099037 18:33571710-33571732 TGGTTGTTTCTGAAGGCATGAGG + Intergenic
1157646809 18:49282127-49282149 AAGTTGATCTGGAAGGCATGTGG + Exonic
1168158148 19:54489865-54489887 CTGATTTTCATGAAGGCATGTGG + Intergenic
927433244 2:23044603-23044625 CACTTATACGTGAAGACATGCGG + Intergenic
929272834 2:39992236-39992258 AACTTGTTCGTAAAGGCATCTGG + Intergenic
941298379 2:163769481-163769503 CAGTTGCTAGGGAAGGCCTGTGG + Intergenic
945119106 2:206440577-206440599 CAGTCGTAGGTGAAGGCAGGTGG - Intergenic
946117686 2:217477914-217477936 CACCTGTTAGGGAAGGCATGGGG - Intronic
948072878 2:235141498-235141520 CAGCTGTTGGTGAAGGCAGCTGG - Intergenic
949034113 2:241808618-241808640 CACTTGTTTGTGGAGGCCTGGGG + Intergenic
1170215316 20:13885138-13885160 CCTTTGTTCTTGAAGGCAGGTGG + Intronic
1174938646 20:54899033-54899055 CAGTTGTTCCTGCAGGCCTTGGG + Intergenic
1175402496 20:58708516-58708538 CAGGTGCTCATGGAGGCATGGGG - Intronic
1175782080 20:61689304-61689326 CAGTGGTTGGTGAAGTGATGTGG + Intronic
1175782111 20:61689448-61689470 CAGTGGTTGGTGAAGTGATGTGG + Intronic
1175782142 20:61689592-61689614 CAGTGGTTGGTGAAGTGATGTGG + Intronic
1181742704 22:24934052-24934074 AAGTTGTTTGTGGAGGCCTGGGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
949351511 3:3128227-3128249 AACTTGTTCGTGGAGGCCTGGGG + Intronic
949413325 3:3788961-3788983 CAGTTCTTCCTGAAGGAATCTGG - Intronic
950690538 3:14652365-14652387 CAGTTGTTAATGCAGGCATAGGG + Intronic
951300563 3:20990922-20990944 CACTTGTTTGTGGAGGCCTGGGG + Intergenic
956228439 3:66986223-66986245 CAGTTGTTCCACAAGGCTTGAGG - Intergenic
957133040 3:76247125-76247147 CAGTTGTTCTTCAAGACATTTGG + Intronic
957136501 3:76295278-76295300 CAGTTGTTACTGGAGGGATGGGG + Intronic
958964464 3:100543491-100543513 CAAGTGTTGGTGAGGGCATGAGG - Intronic
959164525 3:102759538-102759560 CAGTACTTAGTGAAGCCATGGGG + Intergenic
962556357 3:136556355-136556377 CAGTTGTTCAAGTAGGAATGGGG + Intronic
972414701 4:38826965-38826987 AAGTCTTTCCTGAAGGCATGAGG + Exonic
973343877 4:49033253-49033275 CTGTTGTTTGTGAAAACATGAGG - Intronic
975046747 4:69814403-69814425 AACTTGTTTGTGAAGGCCTGAGG - Intronic
975147156 4:70980840-70980862 CAGCTGTTTCTGAGGGCATGTGG + Intronic
987719146 5:21612424-21612446 AACTTGTTTGTGAAGGCCTGAGG + Intergenic
993024987 5:82635010-82635032 CAGTTGTTAGTGAAGCCAGTGGG + Intergenic
995763949 5:115595624-115595646 GAGTTTTTCTTGAAGGCATTAGG - Intronic
997209094 5:132067260-132067282 CAGAAGTTCCTTAAGGCATGGGG - Intergenic
999526898 5:152416678-152416700 CATTTGTAAGTGAAAGCATGTGG - Intronic
1006202268 6:32305218-32305240 AACTTGTTTGTGAAGGCCTGGGG - Intronic
1009896984 6:69763741-69763763 CAGTGGGTCCTGAAGGCATAGGG + Intronic
1013335785 6:109159334-109159356 AAGTTGTTCTAGAAGGCTTGGGG - Exonic
1020895060 7:13929600-13929622 CAGTTGTTCGTGAAGGCATGAGG - Intronic
1021767438 7:23963931-23963953 CAGCTGTTCGTAAAGACAGGAGG - Intergenic
1029607101 7:101605788-101605810 CAGGGGCTGGTGAAGGCATGCGG - Intergenic
1030332414 7:108285207-108285229 TTGTTGTTCTTGCAGGCATGTGG - Intronic
1032706953 7:134428816-134428838 CACTTGTAAGTGAGGGCATGTGG + Intergenic
1033432276 7:141300148-141300170 CATTTGTTCGTGGAGCCATCAGG + Intronic
1039982153 8:42416871-42416893 CAGGTGTTGGTGAGGGCGTGTGG - Exonic
1053150148 9:35738059-35738081 CAGTGGTTCCTGAAGGCCTGTGG - Exonic
1053222014 9:36320129-36320151 AACTTGTTCGTGGAGGCCTGGGG - Intergenic
1057348136 9:94269977-94269999 AACTTGTTTGTGGAGGCATGGGG + Intronic
1188167554 X:26880434-26880456 AACTTGTTTGTGAAGGCCTGGGG + Intergenic
1188419076 X:29974398-29974420 CAAGTGTTGGTGAAGTCATGAGG + Intergenic
1188527271 X:31099915-31099937 CAGCTGTCGGGGAAGGCATGTGG - Intronic
1194966128 X:100290657-100290679 CAGATGTTCATAAAGGCATATGG - Intergenic
1199935741 X:152571860-152571882 CAAATGTTCTTAAAGGCATGTGG + Intergenic
1200375507 X:155775584-155775606 CACCTGTTCGTGAGCGCATGAGG + Exonic