ID: 1020899828

View in Genome Browser
Species Human (GRCh38)
Location 7:13990599-13990621
Sequence CACCGCTCGCCCCCAACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020899828_1020899836 26 Left 1020899828 7:13990599-13990621 CCCAGGGTTGGGGGCGAGCGGTG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1020899828_1020899833 -3 Left 1020899828 7:13990599-13990621 CCCAGGGTTGGGGGCGAGCGGTG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 1020899833 7:13990619-13990641 GTGAGATGGCTCGGGTTTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 78
1020899828_1020899835 25 Left 1020899828 7:13990599-13990621 CCCAGGGTTGGGGGCGAGCGGTG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 1020899835 7:13990647-13990669 AACTAGGACGTTAAGCAGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1020899828_1020899834 9 Left 1020899828 7:13990599-13990621 CCCAGGGTTGGGGGCGAGCGGTG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 1020899834 7:13990631-13990653 GGGTTTCAAGGACAATAACTAGG 0: 1
1: 0
2: 5
3: 12
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020899828 Original CRISPR CACCGCTCGCCCCCAACCCT GGG (reversed) Intronic
900479121 1:2889730-2889752 CACAGCTCGGCCCCCACCCTTGG - Intergenic
901250116 1:7771510-7771532 CACCGCCCACCCCCAGGCCTCGG - Intronic
901814827 1:11788080-11788102 CAGCCCTTGCCCCCATCCCTCGG - Exonic
902410327 1:16208225-16208247 CACTCCTTGCCCCCAACCCTAGG - Exonic
903386538 1:22930564-22930586 CACCGCTCCCCACCTACCCCAGG - Intergenic
903652178 1:24929202-24929224 CACCGTTCGCACCCCACCCGCGG + Intronic
904989118 1:34577201-34577223 CACCCCTCGCCCTCAGCCTTTGG + Intergenic
907394164 1:54178014-54178036 CATCCCTCGCGCCCACCCCTTGG + Intronic
907409381 1:54273870-54273892 CACTGCTCTTCCCCACCCCTAGG - Intronic
908132031 1:61083273-61083295 CACCGCTCACCCCGCACGCTCGG + Intronic
911053238 1:93689743-93689765 CACCACCCACCCCCAACCCCAGG - Intronic
914973499 1:152333956-152333978 CACCTCTCCCCCCAACCCCTTGG + Intergenic
915517409 1:156421380-156421402 CACCGCTCGCCTCGAACCCCCGG - Intronic
915524716 1:156468548-156468570 CACCTCCCACCCCCTACCCTGGG + Intronic
918015763 1:180631420-180631442 CAACCCTCACCCCCAACCCCAGG + Intergenic
1063631205 10:7735187-7735209 CACCTCTTGCTCCCAGCCCTGGG + Intronic
1064324923 10:14340736-14340758 CAACCCTGGCCCCAAACCCTAGG + Intronic
1065872654 10:29969260-29969282 CCCCACTCGCCCCCCACCCCAGG + Intergenic
1067182040 10:43995445-43995467 CACCTCTCCCCCCAATCCCTTGG - Intergenic
1067806282 10:49395563-49395585 CAGCGCTCCCGCCCAGCCCTAGG + Intronic
1069680712 10:70283638-70283660 CACGGCTGGCCCCCAGCCCCAGG + Intronic
1069886957 10:71629807-71629829 CATTTCTCTCCCCCAACCCTTGG - Intronic
1071406633 10:85340675-85340697 CACCACTGCTCCCCAACCCTGGG + Intergenic
1071574168 10:86713919-86713941 CCCTCCTCTCCCCCAACCCTAGG + Intronic
1073408239 10:103317595-103317617 TACCGCTCCACCCCAAGCCTGGG + Intronic
1073800720 10:107038666-107038688 CACTGCCCACCCCCAACCCTGGG + Intronic
1074316212 10:112363952-112363974 CACTGATCACCCTCAACCCTCGG - Intergenic
1075843991 10:125530260-125530282 ACCCGCCAGCCCCCAACCCTGGG + Intergenic
1076255471 10:129021091-129021113 CACCGCCCCCACCCAAGCCTGGG - Intergenic
1077016796 11:401771-401793 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077016808 11:401794-401816 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077016840 11:401864-401886 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077016872 11:401934-401956 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077016884 11:401957-401979 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077016916 11:402027-402049 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077016948 11:402097-402119 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077017010 11:402236-402258 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077017042 11:402306-402328 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077017054 11:402329-402351 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077017086 11:402399-402421 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077017118 11:402469-402491 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077017149 11:402538-402560 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077017175 11:402592-402614 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077017199 11:402645-402667 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077017258 11:402775-402797 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077017326 11:402922-402944 CCCCGCTCACCCCCGACCCCCGG + Intronic
1077317613 11:1926345-1926367 CCCCGCACGCACCCCACCCTCGG + Intronic
1077408579 11:2393311-2393333 CACAGTGCGCCCCCCACCCTTGG + Intronic
1081807740 11:45899630-45899652 CCCCGCTCGCCCCTCCCCCTCGG + Intronic
1081975484 11:47231856-47231878 CTCCCCTCGCCCCCAGCCCCTGG - Intronic
1082010414 11:47446615-47446637 CACCGCACCCGGCCAACCCTGGG - Intronic
1083752039 11:64766221-64766243 CGCCCCTCGCCCCCATCCCAAGG - Intronic
1083894171 11:65611853-65611875 CACCTCTCAGCCTCAACCCTGGG - Intronic
1083900222 11:65640058-65640080 CTCCTCTTGCCCCCAAGCCTGGG + Intronic
1084272362 11:68036165-68036187 CACTGCTCATCCCCACCCCTGGG - Intronic
1084333579 11:68444569-68444591 CACCCCCCACCCCCCACCCTGGG + Intronic
1085050593 11:73378063-73378085 CCCCACTCTCCCCCAACCCAAGG - Intronic
1085519348 11:77129106-77129128 CACCACTCTCCCCCATCCCTTGG + Intronic
1086575775 11:88337715-88337737 CACCGCTAGCCCGCAGCGCTCGG - Exonic
1089685240 11:120142376-120142398 GACCACTCCCTCCCAACCCTGGG - Intronic
1091383627 12:78246-78268 CACCGCCCGCCGCCAGCCCGGGG + Intronic
1092050302 12:5464834-5464856 CATCTCTACCCCCCAACCCTGGG - Intronic
1092237258 12:6818299-6818321 CTCCCCTCTCCCCCAACCCCAGG + Intronic
1092284157 12:7119213-7119235 CACCCCTACCCCCCAGCCCTTGG - Intergenic
1104523321 12:129495643-129495665 CACCACTCCCCTCCAACACTGGG + Intronic
1105927094 13:25018322-25018344 CACCACTCAACCCCATCCCTGGG - Intergenic
1106208339 13:27620227-27620249 CACAGCTCGCCCCGGAGCCTTGG - Intronic
1107468136 13:40667075-40667097 CACCCCGCGCCCCCGGCCCTCGG - Intergenic
1109002114 13:56818383-56818405 CTCCTCTAGCCCCCCACCCTGGG - Intergenic
1110242771 13:73287092-73287114 CACCGCGCCCAGCCAACCCTGGG + Intergenic
1110713231 13:78672927-78672949 CACCTCTCTCCCCCAAGCCAGGG + Intergenic
1113378921 13:109786090-109786112 CGCCCCTCGCCCCAACCCCTGGG - Exonic
1119338127 14:73851858-73851880 CCCAGCTCGCCCCCAGGCCTCGG - Exonic
1121033493 14:90679495-90679517 CACCGCTTACCGCCAACCCCCGG - Intronic
1122344366 14:101049453-101049475 CACCTCCCTGCCCCAACCCTGGG + Intergenic
1122721376 14:103724292-103724314 CACCGTTCCAGCCCAACCCTGGG - Intronic
1122772873 14:104105057-104105079 CACAGCTGGCCCCAGACCCTTGG + Intronic
1125725392 15:41865913-41865935 CAGCGCTCCCTCCCCACCCTCGG - Intronic
1127952047 15:63817737-63817759 CACCCCTCATCCCCAATCCTTGG - Intronic
1128765381 15:70248113-70248135 CACTGCCCACCCCCAACACTGGG + Intergenic
1128800420 15:70493335-70493357 CACAGCTGGGCCCCAGCCCTGGG - Intergenic
1129150875 15:73687030-73687052 CACCCCTCTCCCCCTCCCCTAGG - Intronic
1129321000 15:74774805-74774827 CACCCCCCTCCCCCCACCCTGGG - Intergenic
1132609002 16:805834-805856 CACCGCCCACCCCCAACCCCTGG + Exonic
1132687120 16:1167029-1167051 CACCTCTCGCCCCCAGCTTTTGG + Intronic
1132841126 16:1978993-1979015 CCCCGCTCCTCCCCAGCCCTGGG + Exonic
1133114004 16:3565607-3565629 CACCCCTCCTCCCCAACCCTTGG - Intronic
1133223170 16:4327901-4327923 CAGCCCTCGCCCCAACCCCTGGG + Intronic
1134215083 16:12311194-12311216 AACCCCCCGCCCCCTACCCTAGG + Intronic
1134251831 16:12579584-12579606 CACCTCCCTCCCCCAACACTGGG - Intergenic
1141055784 16:80812478-80812500 CACCCCCCACCCCCATCCCTAGG + Intergenic
1141994823 16:87629673-87629695 CCTCCCTCCCCCCCAACCCTGGG - Intronic
1142598071 17:1039255-1039277 CCCCGCTCCCCTCCACCCCTGGG - Intronic
1142631363 17:1228739-1228761 CGCCGCGCGCCCCCCACCCCGGG - Intronic
1143344552 17:6240266-6240288 CTCTGCTCTCCCCCAAGCCTGGG + Intergenic
1143651977 17:8268886-8268908 CCACCCTTGCCCCCAACCCTCGG - Intronic
1144213056 17:13031456-13031478 CATCACTCACCCCCAAGCCTGGG - Intergenic
1144665309 17:17098418-17098440 CACTTCTCTCCCCCGACCCTCGG + Intronic
1146884898 17:36464281-36464303 CCCCACCCGCCCCCAACCCCAGG - Intergenic
1147325082 17:39666211-39666233 CTCCCCTAGCCCCCAACTCTGGG - Exonic
1147378264 17:40035883-40035905 CTCCTCTCTCCTCCAACCCTGGG + Intronic
1148677114 17:49451901-49451923 CACCTCTCACCCCCCACCCCAGG - Intronic
1148970780 17:51479419-51479441 CACCCCCCACCCCCACCCCTTGG + Intergenic
1149532055 17:57403240-57403262 CTCTGCACGTCCCCAACCCTTGG + Intronic
1149844445 17:59996766-59996788 CCCCTCTCGACCCCAGCCCTTGG - Intergenic
1150643472 17:66964630-66964652 CTCCGCTCGCCCTCCCCCCTCGG - Intergenic
1152305723 17:79519244-79519266 CACCCCACGCCCCCACCCCCAGG + Intergenic
1152945268 17:83194521-83194543 CACCACCCTCCCCCCACCCTTGG - Intergenic
1153480623 18:5543479-5543501 CCGCGCTCGCCCCCAGCCCGAGG + Intronic
1158617181 18:58998995-58999017 CACCGCTCCCGTCCAAGCCTCGG - Intergenic
1160934636 19:1588125-1588147 CACCCCTGCCCCCCAACCCCGGG + Intronic
1160943872 19:1632268-1632290 CACCCCTCGCCCCCAACTCTGGG + Intronic
1162483805 19:10946068-10946090 CACCCCCCCCCCCCACCCCTTGG - Intergenic
1162524057 19:11197379-11197401 TACCCCCCGCCTCCAACCCTGGG - Intronic
1163099475 19:15085690-15085712 CACCTCCCGCCCCCAGCCCCTGG + Intergenic
1163774242 19:19208471-19208493 CACCCCTTGCCCCCACCCCCCGG - Intergenic
1166844661 19:45719353-45719375 CACCTCCCTCCCCCAGCCCTAGG - Intronic
1167591541 19:50406931-50406953 CACCTCCCACCCCCAACCCCTGG + Intronic
927841846 2:26449861-26449883 CACTGCTGGCTCCCATCCCTGGG + Intronic
928097190 2:28412059-28412081 CGCCGATCGCCCCCAGCCCCTGG + Exonic
928495768 2:31829950-31829972 CACCACTTGCCCCCAACCACTGG - Intergenic
932583761 2:73009365-73009387 CACCACTCCTCCCCACCCCTGGG - Intronic
934636222 2:95992111-95992133 CACCACTCAACCCCATCCCTGGG - Intergenic
934797428 2:97113315-97113337 CACCACTCAACCCCATCCCTGGG + Intergenic
934835984 2:97590124-97590146 CACCACTCAACCCCATCCCTGGG - Intergenic
935032250 2:99334310-99334332 CACCACTTGCACCCCACCCTGGG + Intronic
948945602 2:241217630-241217652 CACCGTCCGCCCTCAGCCCTCGG - Intronic
1172952463 20:38730789-38730811 CACCCCTCGGCCCCAGGCCTGGG - Intergenic
1174444862 20:50583851-50583873 CACCCCCCGCCCCCCACCTTTGG + Exonic
1175267310 20:57710325-57710347 CTCCCCTCGCCCCCGTCCCTGGG + Intronic
1175819460 20:61900736-61900758 CAGCGCCCACCCCCAACCCCTGG - Intronic
1175985280 20:62761341-62761363 CACCGCTGGCCGGCAGCCCTGGG + Exonic
1176067662 20:63207074-63207096 CACAGCTCGCCTCCAGCACTTGG - Intronic
1176101037 20:63364746-63364768 CAGCCCCCGCCCCCCACCCTGGG + Intronic
1176418948 21:6499088-6499110 CCCCGATCGCGCCCAACCCCCGG + Intergenic
1178380638 21:32104847-32104869 AACCATTCGCCCCCAACCCCTGG + Intergenic
1179027164 21:37688680-37688702 CACCCCTCTCCCCCACCCCTTGG - Intronic
1179694441 21:43107410-43107432 CCCCGATCGCGCCCAACCCCCGG + Intronic
1179792543 21:43763992-43764014 CACCCATCACCCCCAAGCCTAGG + Intergenic
1179875050 21:44262955-44262977 CACAGCTGCCCCCCAAACCTGGG - Intergenic
1180224267 21:46380446-46380468 CACCGCGCCCGGCCAACCCTGGG + Intronic
1181395142 22:22616195-22616217 CACCGCGCCCAGCCAACCCTCGG + Intergenic
1182466458 22:30519907-30519929 CACCAGTCTCCCCCTACCCTTGG + Intergenic
1183604212 22:38859328-38859350 CACCGCTGACCCTTAACCCTGGG + Intergenic
1184580362 22:45413050-45413072 CAACCCTCGCCCCCCACCCTGGG - Intronic
1185295597 22:50052201-50052223 CACCGTTCTCCCCAAAGCCTCGG - Intronic
952237815 3:31498456-31498478 CACCCCCCACCCCCACCCCTTGG - Intergenic
952767891 3:36970863-36970885 CCCCCCATGCCCCCAACCCTTGG + Intergenic
952885625 3:38009635-38009657 CACAGCTCCCCCTCAAACCTTGG + Exonic
954645991 3:52131849-52131871 AAACGCGCGCCTCCAACCCTGGG + Intronic
954663475 3:52238120-52238142 CACCCCCAGCCCCCAGCCCTAGG - Intronic
954800308 3:53183369-53183391 CCTAGCTCTCCCCCAACCCTGGG - Intronic
957048735 3:75395987-75396009 CACCACTCAACCCCATCCCTGGG - Intergenic
959056692 3:101574338-101574360 CACCCCACTCCCCCCACCCTGGG - Intronic
960228515 3:115196005-115196027 CACCGCTCCCCCCCACCCCCTGG - Intergenic
960989603 3:123301910-123301932 CCCCGCTCCGCCCCACCCCTGGG - Intronic
963019299 3:140857142-140857164 CACTGGTGACCCCCAACCCTGGG + Intergenic
964590944 3:158361290-158361312 CACCGCTGGCCCCCAAAGCATGG + Intronic
967264316 3:187676809-187676831 CACCCATAACCCCCAACCCTAGG + Intergenic
967986732 3:195100749-195100771 CCCTCCTCGCCCCCAAGCCTTGG + Intronic
968759103 4:2432966-2432988 CACCCCTTGCCCCCACCCCCAGG + Intronic
969682273 4:8649851-8649873 CACCCCACGGCCCCAGCCCTCGG - Intergenic
985231013 4:187817668-187817690 CTCCCCTTTCCCCCAACCCTTGG + Intergenic
988264062 5:28927876-28927898 CACCACTCAACCCCATCCCTGGG - Intergenic
990002481 5:50910419-50910441 CACCCCTCGACCCCGATCCTTGG + Intergenic
990640672 5:57780388-57780410 CACCGCACCTCCCAAACCCTGGG - Intergenic
993044715 5:82854185-82854207 CACTGGTCTACCCCAACCCTAGG - Intergenic
997463473 5:134071366-134071388 CGCCCCTTCCCCCCAACCCTGGG + Intergenic
998458935 5:142295240-142295262 CACGCCTCACCCCCACCCCTGGG + Intergenic
999765217 5:154735408-154735430 CACCACTCTCCTCCAAGCCTGGG + Intronic
1001753035 5:174146040-174146062 TTCCGCTCACCCCCAACCCAGGG + Intronic
1004500809 6:16208312-16208334 CACCGCTCCAGCCCAGCCCTGGG + Intergenic
1006514001 6:34536051-34536073 CACCCCTTGCCCCCAACCTCAGG + Intergenic
1007367777 6:41406909-41406931 CCTCGCCCGCCCCCAAGCCTAGG - Intergenic
1007625313 6:43243359-43243381 CTCCGCTCTCCTCCAGCCCTGGG - Intergenic
1007975434 6:46096244-46096266 CAGCCCTCACCCCCAACACTGGG + Intergenic
1013141043 6:107335074-107335096 CTCAGCACCCCCCCAACCCTGGG - Intronic
1016490433 6:144594788-144594810 CACCGCACTGCCCCAGCCCTAGG + Intronic
1020899828 7:13990599-13990621 CACCGCTCGCCCCCAACCCTGGG - Intronic
1024096554 7:45987125-45987147 CCCCACTCACCCGCAACCCTGGG - Intergenic
1025939269 7:66062210-66062232 CAGCTCTCTCCCCCAACACTGGG + Intergenic
1026017411 7:66682173-66682195 CACCGCTCGCCCACGTCGCTCGG - Intronic
1026968179 7:74453560-74453582 CACCGCTCCCCACCACCACTGGG - Intergenic
1029246511 7:99205949-99205971 CACCCCCCGTCCCCAGCCCTTGG + Intronic
1029441088 7:100586901-100586923 CCCCGCCCGCCCCCAGCCCGGGG - Intronic
1030082010 7:105786323-105786345 CACCTGCCTCCCCCAACCCTGGG - Intronic
1030347863 7:108454977-108454999 CACCGCTCGGCGCCCTCCCTCGG + Intronic
1030714266 7:112790179-112790201 CAACGCGCTCTCCCAACCCTCGG + Exonic
1035300073 7:157891408-157891430 CACCCCCCGCCCCCCACCCCAGG + Intronic
1036585353 8:10118599-10118621 CACCGCTCCGCCCACACCCTGGG + Intronic
1038147913 8:24914915-24914937 CGCCGCGCGCCCCCGACACTTGG + Intronic
1041795106 8:61738703-61738725 CCCCGCTCTTCCCCACCCCTGGG - Intergenic
1042591566 8:70402973-70402995 CGCCCCTCGCCCCCCACCCCCGG + Intronic
1045041195 8:98226635-98226657 CACCCCTCGCCCCCAACTCCAGG - Intronic
1045837333 8:106537530-106537552 CTCCCCCAGCCCCCAACCCTAGG - Intronic
1047452040 8:124973444-124973466 CTCCTCTAGCCCGCAACCCTCGG - Intronic
1047648361 8:126893112-126893134 CTCCTCTAGCCCCCTACCCTAGG + Intergenic
1049290827 8:141800787-141800809 CACCCCTAGCCCCAAACACTGGG - Intergenic
1049697117 8:143989893-143989915 CACCGCCCGACCCCACCCCTCGG + Intronic
1051313008 9:15796759-15796781 CAACGCTCCTCCCCAACCCCAGG - Intronic
1053313854 9:37035891-37035913 CACCCCCCGCCCCCAGCCCGGGG - Intergenic
1061428663 9:130517401-130517423 CACCTCCCCTCCCCAACCCTGGG - Intergenic
1061938526 9:133871860-133871882 CAGGGCTGGCCCCCACCCCTGGG - Intronic
1062290593 9:135792626-135792648 CAGCCCTGGCCCCCAGCCCTTGG - Exonic
1062527817 9:136985348-136985370 CACCCCGCGCCCCCTTCCCTGGG - Exonic
1189262484 X:39688685-39688707 CCCTGGTCGCCCCCACCCCTGGG - Intergenic
1189282901 X:39831735-39831757 CCCCACCCGCCCCCACCCCTTGG + Intergenic
1190042536 X:47082791-47082813 CACCACCCGCCCCCAACCCATGG + Intronic
1197698014 X:129571618-129571640 CACCGCTCGCAGCCAACCTTGGG + Intronic
1198023867 X:132685675-132685697 CACTTCTGGCCCCCAACCATAGG + Intronic
1198785546 X:140283811-140283833 CATCACTCTCCCCCAACCCCAGG - Intergenic
1198854512 X:141002461-141002483 CACCCCTCGCCCGCAAGCCCAGG + Intergenic
1198877505 X:141242667-141242689 CACCCCTCGCCCGCAAGCCCAGG - Intergenic
1198908188 X:141584888-141584910 CACCCCTCGCCCGCAAGCCCAGG - Exonic
1198908603 X:141589536-141589558 CACCCCTCGCCCGCAAGCCCAGG + Exonic
1198918467 X:141698616-141698638 CACCCCTCGCCCGCAAGCCCAGG - Exonic