ID: 1020899829

View in Genome Browser
Species Human (GRCh38)
Location 7:13990600-13990622
Sequence TCACCGCTCGCCCCCAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020899829_1020899836 25 Left 1020899829 7:13990600-13990622 CCAGGGTTGGGGGCGAGCGGTGA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1020899829_1020899834 8 Left 1020899829 7:13990600-13990622 CCAGGGTTGGGGGCGAGCGGTGA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 1020899834 7:13990631-13990653 GGGTTTCAAGGACAATAACTAGG 0: 1
1: 0
2: 5
3: 12
4: 109
1020899829_1020899835 24 Left 1020899829 7:13990600-13990622 CCAGGGTTGGGGGCGAGCGGTGA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 1020899835 7:13990647-13990669 AACTAGGACGTTAAGCAGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1020899829_1020899833 -4 Left 1020899829 7:13990600-13990622 CCAGGGTTGGGGGCGAGCGGTGA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 1020899833 7:13990619-13990641 GTGAGATGGCTCGGGTTTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020899829 Original CRISPR TCACCGCTCGCCCCCAACCC TGG (reversed) Intronic
900289243 1:1916903-1916925 CCACCACCCGCCCCCAACCCGGG - Intronic
900989289 1:6090604-6090626 TGCCCCCTCGCCCCCCACCCTGG - Intronic
902250436 1:15151623-15151645 TCACCCCCCGCCCCCACCCCAGG + Intergenic
902401026 1:16156837-16156859 GCACCCCTGGCCCCCGACCCTGG + Intergenic
903181473 1:21607091-21607113 TCACACCTCACCCTCAACCCAGG - Intronic
904097509 1:27992265-27992287 AAACCTCTCGCCCCCCACCCAGG - Intronic
907242594 1:53088988-53089010 CCACCACTCACCCCCAACCTTGG - Intronic
907585202 1:55610777-55610799 TCACCCCTAATCCCCAACCCAGG - Intergenic
907906102 1:58784522-58784544 CCACCCCTCGCCCGCACCCCTGG - Intergenic
915843554 1:159238349-159238371 ACACCCCACGCCCCCACCCCCGG + Intergenic
919847109 1:201649152-201649174 GCTCCGCTCGCGCCCAACCTGGG + Exonic
1064582660 10:16809985-16810007 TCACCTCCCCCCCCCACCCCCGG - Intronic
1065509456 10:26463885-26463907 CCGCCACTTGCCCCCAACCCCGG + Intronic
1069849485 10:71396196-71396218 TCACGGGTCTCCTCCAACCCGGG + Intergenic
1073800719 10:107038665-107038687 ACACTGCCCACCCCCAACCCTGG + Intronic
1075843990 10:125530259-125530281 TACCCGCCAGCCCCCAACCCTGG + Intergenic
1076702637 10:132282079-132282101 GCACCTGTCGCCCCCACCCCCGG - Intronic
1078546844 11:12253083-12253105 TCACCCCTCACCCCCAGCTCTGG - Intronic
1080230814 11:30016670-30016692 CCACCCCCCGCCCCCCACCCAGG - Exonic
1083659987 11:64247450-64247472 CCACCGCTCACCCCCAGCCCCGG - Intergenic
1083668310 11:64286897-64286919 CCACCTCCCGCCCCCCACCCGGG - Intronic
1083708657 11:64534024-64534046 TCCCAGCTCGCCCCCCAACCTGG - Intergenic
1084272363 11:68036166-68036188 TCACTGCTCATCCCCACCCCTGG - Intronic
1089685241 11:120142377-120142399 TGACCACTCCCTCCCAACCCTGG - Intronic
1091383626 12:78245-78267 GCACCGCCCGCCGCCAGCCCGGG + Intronic
1091642331 12:2246802-2246824 TCACCCCTCACCCCCAACCTTGG - Intronic
1092050303 12:5464835-5464857 TCATCTCTACCCCCCAACCCTGG - Intronic
1096260232 12:50085577-50085599 TCCCCGCTCGGCCCCGCCCCCGG - Intronic
1096541439 12:52309584-52309606 TCACCCGCCGCCCCCACCCCAGG + Intergenic
1099854199 12:88142742-88142764 TCTTCGCTCGCCCCCAAACGAGG - Intronic
1103700662 12:122847297-122847319 TCACCCCTCCCCCCCCGCCCCGG - Intronic
1103902844 12:124312154-124312176 CCACCCCACGCCCCCACCCCAGG + Intronic
1105317751 13:19282721-19282743 CCTCCCCTTGCCCCCAACCCCGG - Intergenic
1110713230 13:78672926-78672948 TCACCTCTCTCCCCCAAGCCAGG + Intergenic
1111949891 13:94702077-94702099 TCACCACCCGCCCCCACCCATGG - Intergenic
1112247446 13:97747715-97747737 TCACCCCCAGCACCCAACCCAGG + Intergenic
1114673739 14:24428257-24428279 TCAGCACTGGCCCCCATCCCCGG - Intronic
1115752102 14:36504156-36504178 AGAGCGCTCGCCCCCACCCCTGG + Intronic
1118925549 14:70187902-70187924 TCCCTGCTAGCCCCCAAACCCGG + Intronic
1118951923 14:70442800-70442822 TCACGGTTCTCCCCCAGCCCAGG + Intergenic
1120711472 14:87797741-87797763 CCACTGCTCCACCCCAACCCAGG + Intergenic
1123101025 14:105800941-105800963 TCACCCCTCACCCCAAACCCTGG - Intergenic
1123558002 15:21452301-21452323 GCACCACTCGCTCCCAGCCCAGG + Intergenic
1123594230 15:21889582-21889604 GCACCACTCGCTCCCAGCCCAGG + Intergenic
1123709974 15:22980162-22980184 CCCCCCCTCCCCCCCAACCCCGG - Intronic
1124014411 15:25863358-25863380 TCGCCGCCCGCCCCCGGCCCGGG + Intronic
1124118395 15:26867860-26867882 GCACCGCGCGCTCCCAGCCCAGG + Intronic
1124406394 15:29396261-29396283 TCCCCTCTCTCCCCCAGCCCCGG + Intronic
1130076807 15:80696123-80696145 TCTCCGCTGGCCCTCAGCCCCGG - Intronic
1131074401 15:89486226-89486248 TCACCGCCCCCACCCACCCCAGG - Intronic
1202966354 15_KI270727v1_random:179473-179495 GCACCACTCGCTCCCAGCCCAGG + Intergenic
1132841124 16:1978992-1979014 TCCCCGCTCCTCCCCAGCCCTGG + Exonic
1133220267 16:4316575-4316597 TCGCCGCACGCCCCCCACCGCGG - Intronic
1134013447 16:10871910-10871932 ACACAGCTTGCCCCCAAGCCTGG + Intergenic
1134251832 16:12579585-12579607 TCACCTCCCTCCCCCAACACTGG - Intergenic
1135485791 16:22863567-22863589 TCAACCCTTGCCCCCAACCCTGG + Intronic
1136453801 16:30369657-30369679 CCCCCGCTTGCCCCCAAGCCGGG - Exonic
1137392144 16:48090851-48090873 CCACCGCTCGCCACCATGCCTGG + Intronic
1137672678 16:50288375-50288397 TCACGTCTCGGCCCCAACCTTGG + Intronic
1142631364 17:1228740-1228762 CCGCCGCGCGCCCCCCACCCCGG - Intronic
1143149923 17:4801500-4801522 TCCTCCCTCACCCCCAACCCAGG + Intergenic
1143661516 17:8327258-8327280 TCAGCGCTCGCCTCCCACGCGGG + Intergenic
1144213057 17:13031457-13031479 TCATCACTCACCCCCAAGCCTGG - Intergenic
1146547558 17:33751932-33751954 CCACCCCTCACCCCCACCCCCGG - Intronic
1147168621 17:38605778-38605800 TCCTCGCTCGGCCCCAGCCCCGG + Exonic
1151826580 17:76527294-76527316 TCACCTCTGTCCCCCATCCCCGG - Intergenic
1152823604 17:82449895-82449917 TCACCGTACGCTCCCAACACTGG + Intronic
1160592677 18:79952664-79952686 TCACCCCTCACCCCTCACCCAGG - Intergenic
1160824133 19:1071525-1071547 TCCCCGCACACCCCCTACCCGGG - Intronic
1160934635 19:1588124-1588146 CCACCCCTGCCCCCCAACCCCGG + Intronic
1160943871 19:1632267-1632289 ACACCCCTCGCCCCCAACTCTGG + Intronic
1161900565 19:7115969-7115991 TCCCCACTCCCCGCCAACCCCGG + Intronic
1163293107 19:16393735-16393757 TCACTGCCCGCACCCCACCCTGG - Intronic
1164633063 19:29774177-29774199 TCCCAGCTCCCCTCCAACCCAGG - Intergenic
1164747440 19:30626830-30626852 TCCCCGCACGGCCCCCACCCCGG + Intronic
1165863560 19:38922190-38922212 TCCCTGCCCACCCCCAACCCTGG + Intronic
1167649008 19:50719532-50719554 TCCCCGCCCGCCCCCTCCCCGGG - Intergenic
925078862 2:1044123-1044145 CCACCGCTGCCCCCCCACCCCGG + Intronic
925109085 2:1318511-1318533 TCATCGCTCTCCCCCAGCCCAGG - Intronic
927721271 2:25384136-25384158 ACACTGCACGCCCCCAGCCCTGG - Intronic
929200406 2:39229083-39229105 TTTACGCTCGCCCCCAACCCTGG - Intronic
932583762 2:73009366-73009388 TCACCACTCCTCCCCACCCCTGG - Intronic
932618263 2:73249898-73249920 TCACCTCTCGCCTCCAATCTGGG - Exonic
934048519 2:88191008-88191030 ACACCCCCAGCCCCCAACCCAGG - Intergenic
935669660 2:105544250-105544272 TCACCTCTCGCCTCTCACCCAGG + Intergenic
940108010 2:150119901-150119923 TCACCCCTGGTCCCCAATCCTGG + Intergenic
944878276 2:203985129-203985151 TCAATGCCCACCCCCAACCCAGG - Intergenic
1174196211 20:48774639-48774661 CCACCTCTCTCCCCCAACCTGGG + Intronic
1174401848 20:50280257-50280279 TCACCTCCTGCCCCCAGCCCAGG + Intergenic
1175276647 20:57775173-57775195 TCACCCCTCTGTCCCAACCCAGG - Intergenic
1175335364 20:58192718-58192740 TCACCCCTCACCTGCAACCCAGG + Intergenic
1179035185 21:37753285-37753307 TCACAGCTGGCCCCCAAGTCAGG - Intronic
1179906765 21:44426761-44426783 TCCCAGCTGGCCCCAAACCCAGG + Intronic
1180169655 21:46051172-46051194 TCACCGGTAGCCCCCACTCCAGG + Intergenic
1180991294 22:19938372-19938394 TCACCGCTGGAGCCCATCCCAGG - Intronic
1181951135 22:26554553-26554575 TCCCCACTGACCCCCAACCCAGG - Intronic
1183343714 22:37295689-37295711 TCAGCCCTCGCCCCCTCCCCCGG + Intronic
1183417846 22:37692728-37692750 TCACTGCTCACCCCCACTCCAGG - Exonic
1184580363 22:45413051-45413073 CCAACCCTCGCCCCCCACCCTGG - Intronic
1185184857 22:49392924-49392946 TCACAGCCCGCCCCGAATCCAGG - Intergenic
1185275519 22:49948874-49948896 TCCCCGCTGTCCCCCAGCCCTGG + Intergenic
950341660 3:12251623-12251645 TCACCCCTCACCCCCAGTCCTGG - Intergenic
952436484 3:33277320-33277342 CCACCCCTCGCCCCCGGCCCTGG - Intronic
952900348 3:38108212-38108234 TCTCCTCTCCTCCCCAACCCTGG - Intronic
953027405 3:39153134-39153156 TCGCCGCTCGCGCGCAAGCCCGG + Intronic
960080177 3:113532963-113532985 TCTGCGCTCGCCCCCTCCCCAGG + Exonic
961695067 3:128698646-128698668 CCACCCCCCGCCCCCAACCCAGG + Intergenic
961703455 3:128765137-128765159 CCAGCGCTCGTCCCCCACCCCGG - Intronic
964867296 3:161275795-161275817 TTCCCGTTTGCCCCCAACCCTGG - Intergenic
965724089 3:171695736-171695758 CCACCCCACCCCCCCAACCCAGG + Intronic
966311276 3:178596690-178596712 CCAACCCCCGCCCCCAACCCAGG + Intronic
971626678 4:28929774-28929796 CCCTCGCTCGCCCCCAACCACGG + Intergenic
973531858 4:51843405-51843427 TCACCGCCCGCCCCGGCCCCGGG - Intronic
973623767 4:52751455-52751477 GCCCCGCTCCGCCCCAACCCAGG - Exonic
975663488 4:76710221-76710243 TCACCTCTGGCCCCCAGCACAGG + Exonic
991136327 5:63186136-63186158 TCTCCTCTCACCCCCACCCCAGG - Intergenic
991584408 5:68187602-68187624 TCCCCGCCCGCTCCCAAGCCCGG - Intergenic
993495411 5:88603234-88603256 TCCCCGCCCGCCCCCTCCCCCGG + Intergenic
995028526 5:107452212-107452234 CCTCCCCTCACCCCCAACCCCGG - Intronic
996404034 5:123089582-123089604 TCGCCGCCCGCCCCCAACCTAGG - Intronic
997463472 5:134071365-134071387 TCGCCCCTTCCCCCCAACCCTGG + Intergenic
997513177 5:134466702-134466724 CCACCCCTCGCCCCAATCCCAGG - Intergenic
998136100 5:139675500-139675522 TGACAGCTTGCCCCCAACCACGG + Intronic
999286990 5:150400008-150400030 TCACCCCACTCCCCCAACACAGG + Exonic
1001753034 5:174146039-174146061 GTTCCGCTCACCCCCAACCCAGG + Intronic
1002493895 5:179599083-179599105 TCACCGGTCGCTCCCTCCCCAGG - Intronic
1003271936 6:4615000-4615022 TCACCTCTCACCACCAACTCTGG + Intergenic
1004500808 6:16208311-16208333 TCACCGCTCCAGCCCAGCCCTGG + Intergenic
1006116940 6:31780568-31780590 TCACATCTCACCCCCGACCCAGG - Exonic
1006379406 6:33688834-33688856 TCAAGGCTCTGCCCCAACCCAGG - Intronic
1007072704 6:39048758-39048780 CCACCGCCCGCCACCAGCCCGGG + Intergenic
1011519831 6:88193401-88193423 TCACAGCTGGTCCCCAGCCCAGG - Intergenic
1011610622 6:89146647-89146669 TCCCGGGTCGCCCCCGACCCGGG - Intronic
1014547649 6:122751887-122751909 TCATCCCTCTGCCCCAACCCAGG + Intergenic
1015768012 6:136739456-136739478 TCACCCCTCACTCCCACCCCAGG + Intronic
1019126170 6:169841402-169841424 TCACGGCGCGCCCTCAACCTTGG - Intergenic
1019197233 6:170289870-170289892 TCTCCGCACACCCCCCACCCAGG - Intronic
1019363501 7:618034-618056 TCACCGCCCCCACCAAACCCAGG + Intronic
1020107435 7:5428570-5428592 TCTCCGCTCGAGCCCAACTCCGG + Intergenic
1020899829 7:13990600-13990622 TCACCGCTCGCCCCCAACCCTGG - Intronic
1024096556 7:45987126-45987148 TCCCCACTCACCCGCAACCCTGG - Intergenic
1025824492 7:64999255-64999277 TCACGGGTCTCCCCCAGCCCGGG + Intronic
1029441090 7:100586902-100586924 CCCCCGCCCGCCCCCAGCCCGGG - Intronic
1029699287 7:102235882-102235904 TCGCCGTTCTCACCCAACCCGGG + Intronic
1030535126 7:110757188-110757210 TCACCCCTTGCCTCCAACACTGG - Intronic
1031665728 7:124480571-124480593 TCACCGCTGTTCCCCATCCCAGG - Intergenic
1038335016 8:26639014-26639036 TCACCCCTCTCCCATAACCCGGG + Intronic
1039875147 8:41578487-41578509 TCCGCGCCCGCCCCGAACCCCGG + Intronic
1039933122 8:42013034-42013056 TCATCACCCTCCCCCAACCCTGG - Intronic
1040104441 8:43533677-43533699 TCACCTCTCTCCACCATCCCTGG + Intergenic
1045657056 8:104398274-104398296 TCACAGCTGGCCCTAAACCCAGG - Intronic
1049088497 8:140495847-140495869 TCACCCCTGTCCCCCACCCCTGG + Intergenic
1050947620 9:11546150-11546172 TCACTGCTCTCCCCAAATCCAGG + Intergenic
1053313855 9:37035892-37035914 ACACCCCCCGCCCCCAGCCCGGG - Intergenic
1056817292 9:89811327-89811349 TCACTGCTGGCCACCATCCCAGG - Intergenic
1058517969 9:105794852-105794874 TCACCCCTCTCTCCCAGCCCTGG - Intergenic
1060186024 9:121564668-121564690 TCACCCCTCCTCCCCAACCTCGG - Intergenic
1060889213 9:127177580-127177602 TCAGCCCTAGCCCCCAGCCCAGG + Intronic
1061170110 9:128947648-128947670 TGACCGCTCGCCCCCGGACCCGG - Intronic
1061428664 9:130517402-130517424 TCACCTCCCCTCCCCAACCCTGG - Intergenic
1061768212 9:132896294-132896316 TCACCCGTCTCCCCCGACCCCGG - Exonic
1061886471 9:133593509-133593531 TCACCTCTCCCTCCCAGCCCCGG + Intergenic
1062277058 9:135736188-135736210 CCACCCCTAGCCCCCAGCCCTGG - Intronic
1062323357 9:136001257-136001279 TCACCCCCAGCCCCCAGCCCTGG + Intergenic
1062340816 9:136093342-136093364 TCACCACTAGCCCCCTGCCCAGG + Intronic
1187698232 X:21941304-21941326 TCGGCGCACGCCCCCAGCCCGGG - Intronic
1189262486 X:39688686-39688708 TCCCTGGTCGCCCCCACCCCTGG - Intergenic
1191253374 X:58269687-58269709 CCACCCCCCGCCCCCACCCCGGG + Intergenic
1194510444 X:94787265-94787287 TTACTACTCTCCCCCAACCCCGG - Intergenic
1196659273 X:118252880-118252902 TCTCCCCTCTCCCCCAACCAAGG - Intergenic
1197698013 X:129571617-129571639 CCACCGCTCGCAGCCAACCTTGG + Intronic
1198595305 X:138229592-138229614 TCACCACTCACTCCCATCCCTGG + Intergenic
1201162017 Y:11173529-11173551 CCACCCCCCTCCCCCAACCCCGG - Intergenic