ID: 1020899836

View in Genome Browser
Species Human (GRCh38)
Location 7:13990648-13990670
Sequence ACTAGGACGTTAAGCAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020899829_1020899836 25 Left 1020899829 7:13990600-13990622 CCAGGGTTGGGGGCGAGCGGTGA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG 0: 1
1: 0
2: 0
3: 2
4: 58
1020899828_1020899836 26 Left 1020899828 7:13990599-13990621 CCCAGGGTTGGGGGCGAGCGGTG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG 0: 1
1: 0
2: 0
3: 2
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020899836 Original CRISPR ACTAGGACGTTAAGCAGTGA GGG Intronic
906088223 1:43154751-43154773 ACTATGAGGTTTTGCAGTGAGGG + Intronic
906804919 1:48771519-48771541 ACTGGGATGTTAACCATTGAGGG - Intronic
914424719 1:147565034-147565056 ACTAGAACGTTCTGCAGAGATGG - Intronic
918198578 1:182245829-182245851 AATAGAACGTTGTGCAGTGATGG - Intergenic
1062769815 10:90554-90576 ACTAGGTTGTAAAACAGTGATGG - Intergenic
1063299561 10:4839793-4839815 AAGAGGACGGTAAGCAGTCACGG - Exonic
1063698777 10:8364423-8364445 TCTATGAAGTTAAGCAGTGAGGG + Intergenic
1065715724 10:28565532-28565554 ACTAGAACATTAAGCAGAGCTGG - Intronic
1072799756 10:98384855-98384877 AGGAGGAAGTTAAGCAATGAAGG - Intronic
1081878804 11:46430056-46430078 ACTAGCACGATAAACAGAGAAGG + Intronic
1083551686 11:63594724-63594746 TGTAGGGCGTTAAGCAGAGAAGG + Intronic
1090899705 11:131017662-131017684 ACTAGGATTTAAAGCAGGGAAGG - Intergenic
1102721997 12:115024353-115024375 ACTAGGAGGTTAATCAATGAAGG + Intergenic
1104196126 12:126540138-126540160 CCCAGGACGTGGAGCAGTGAGGG - Intergenic
1114481089 14:23034948-23034970 AATAGGAAGTGAAGCTGTGACGG - Exonic
1114867037 14:26608431-26608453 ACTAGTATGTGAAGCAGGGAGGG + Intergenic
1116766181 14:49072768-49072790 ACTAAGAAGTTAAAAAGTGAGGG + Intergenic
1117834677 14:59791385-59791407 GCTGGGACTTTAAGCAGTTACGG + Intronic
1125399432 15:39284573-39284595 CCTAAGACACTAAGCAGTGATGG + Intergenic
1126636089 15:50781148-50781170 AATAGGACATTCTGCAGTGATGG - Intergenic
1128779362 15:70348715-70348737 ACTGGGACGCAAAGCAGTGTGGG - Intergenic
1132464287 16:70672-70694 CCTGGGACCTTAGGCAGTGATGG - Intronic
1142192102 16:88722766-88722788 ACTAGGCTGTTAAGCAGGCAGGG + Intronic
1147418637 17:40311099-40311121 ACAAGGACGCCAAGCAGGGATGG - Intronic
1156570541 18:38247177-38247199 ACTAGAAAATTAAGCAGAGATGG - Intergenic
1156894805 18:42233640-42233662 ACTAATACTTTAAGCAGTTAAGG - Intergenic
1163793827 19:19324123-19324145 AGTAAGAGGTTAGGCAGTGATGG + Intronic
929996541 2:46829547-46829569 CCTAGGACGTGAGACAGTGACGG - Intronic
930611328 2:53547330-53547352 GCTAGGACTTGAGGCAGTGAGGG - Intronic
932322642 2:70833497-70833519 GCTAGGAAGTTAAGGAGAGAGGG - Intronic
932811076 2:74826796-74826818 ACTATGTCTTTAAGCACTGATGG + Intergenic
937781126 2:125838439-125838461 ACTAGGAAGTTAGGCAGGCATGG - Intergenic
947770540 2:232666837-232666859 ACTAGGGCCTTAAGCAGAGGTGG - Intronic
1171943221 20:31351047-31351069 ACCAGGACAATAAGCAGAGAAGG + Intergenic
1179173377 21:38990340-38990362 GCTAGGACGTTAAACAGAGCAGG + Intergenic
956779631 3:72593804-72593826 ACTAGGTCTTTACCCAGTGATGG + Intergenic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
973148061 4:46854501-46854523 AATAGAACTTTCAGCAGTGATGG - Intronic
980567674 4:134565387-134565409 ACAAGTATGTGAAGCAGTGAAGG - Intergenic
988777433 5:34490210-34490232 CCTAAGATATTAAGCAGTGAAGG - Intergenic
990428879 5:55714969-55714991 ACTACCTCGTTAAGCATTGAAGG + Intronic
993345659 5:86778904-86778926 ACTAGAACTTTCTGCAGTGAGGG + Intergenic
997000300 5:129751511-129751533 TCTAGGAAAATAAGCAGTGATGG + Intronic
1005389278 6:25316982-25317004 ACTGGGAAGTTGAGCAGAGAGGG + Intronic
1011831671 6:91380514-91380536 ACTAGAACCTTATGCAGTAATGG - Intergenic
1013387081 6:109642409-109642431 ACTAGGGAATTAATCAGTGAAGG - Intronic
1013856037 6:114573360-114573382 ACTAAGACCTTGAGCAGTGCTGG + Intergenic
1016082525 6:139873347-139873369 AACAGGACGATAAGCAGTGGAGG + Intergenic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1021288146 7:18808164-18808186 AAAAGCACGTGAAGCAGTGAAGG + Intronic
1021806004 7:24356123-24356145 ACTAGAACGTTCTGCAATGATGG + Intergenic
1024745644 7:52402932-52402954 ACTTGGACATTAAGCAAAGAAGG + Intergenic
1035808096 8:2470257-2470279 ACGAGGACATTTATCAGTGAGGG - Intergenic
1036770412 8:11575020-11575042 ACAGGGACGATAAGCGGTGATGG - Intergenic
1046844986 8:118905638-118905660 ACTAGGTCTTTAAGGAGGGATGG - Intergenic
1051980357 9:23007232-23007254 GCTAGTTCATTAAGCAGTGAAGG + Intergenic
1055391369 9:75825592-75825614 AGTAGGACATGAAGCAGTAAAGG - Intergenic
1056754705 9:89374408-89374430 AGTAGGACCTCCAGCAGTGAAGG + Intronic
1060332722 9:122688570-122688592 ACTACAACTTTGAGCAGTGAAGG + Intergenic
1186472661 X:9833550-9833572 ACTAGGACATTGAGCGCTGAAGG + Intronic
1197955184 X:131938902-131938924 ACTTGGAAGTTAAGCAGGGTCGG - Intergenic