ID: 1020906203

View in Genome Browser
Species Human (GRCh38)
Location 7:14067210-14067232
Sequence CGGCAAACAGCAGTGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020906203_1020906215 24 Left 1020906203 7:14067210-14067232 CCGCCCACCACTGCTGTTTGCCG No data
Right 1020906215 7:14067257-14067279 CCATCCCTCCAGATCTGGCAGGG 0: 17
1: 43
2: 88
3: 172
4: 289
1020906203_1020906212 19 Left 1020906203 7:14067210-14067232 CCGCCCACCACTGCTGTTTGCCG No data
Right 1020906212 7:14067252-14067274 GACTTCCATCCCTCCAGATCTGG 0: 29
1: 69
2: 102
3: 85
4: 220
1020906203_1020906213 23 Left 1020906203 7:14067210-14067232 CCGCCCACCACTGCTGTTTGCCG No data
Right 1020906213 7:14067256-14067278 TCCATCCCTCCAGATCTGGCAGG 0: 17
1: 36
2: 91
3: 149
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020906203 Original CRISPR CGGCAAACAGCAGTGGTGGG CGG (reversed) Intergenic
No off target data available for this crispr