ID: 1020916443

View in Genome Browser
Species Human (GRCh38)
Location 7:14199504-14199526
Sequence CTCTGCAGGCGGCCTGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 1, 2: 4, 3: 36, 4: 333}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020916436_1020916443 18 Left 1020916436 7:14199463-14199485 CCACCATGAAATCAAAGTAAGAT 0: 1
1: 0
2: 1
3: 31
4: 263
Right 1020916443 7:14199504-14199526 CTCTGCAGGCGGCCTGGGACAGG 0: 1
1: 1
2: 4
3: 36
4: 333
1020916437_1020916443 15 Left 1020916437 7:14199466-14199488 CCATGAAATCAAAGTAAGATAGA 0: 1
1: 1
2: 0
3: 31
4: 409
Right 1020916443 7:14199504-14199526 CTCTGCAGGCGGCCTGGGACAGG 0: 1
1: 1
2: 4
3: 36
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020916443 Original CRISPR CTCTGCAGGCGGCCTGGGAC AGG Intronic
900786809 1:4654795-4654817 CTCTGCAGACGGCCGCGGCCCGG - Intronic
901024834 1:6273756-6273778 CTCTGCACTCGCCCTGGGATGGG - Intronic
901135446 1:6990066-6990088 ATCTGCAGACGGGCTGGGAGGGG + Intronic
901845878 1:11981701-11981723 CCCTGCAGGAGCCCTGGGAAAGG - Intronic
902213084 1:14917535-14917557 CTCTGCATGGGGCCTGGCATAGG - Intronic
902645868 1:17797550-17797572 CTCTGCAGGCGGACAGGGCCAGG + Intronic
902823490 1:18957071-18957093 CTCGGCAGGCGACGTGGGAGAGG - Intergenic
904081961 1:27877840-27877862 CTTAGAAGGGGGCCTGGGACAGG + Intronic
905999142 1:42408707-42408729 CACTGCACCTGGCCTGGGACTGG + Intronic
906256589 1:44355198-44355220 CTGTTCAGGCGGCCGGGAACGGG - Exonic
906848784 1:49224720-49224742 CTCTGCAGCAGGCCTTGTACTGG + Intronic
907299331 1:53476781-53476803 CTCTGCTGTCGGCTTGGGTCTGG - Intergenic
912514020 1:110206946-110206968 CTCTGCAGGCTGCTTGGGGTTGG + Intergenic
912911018 1:113759239-113759261 CCCTGTAGGCGGCCTCTGACCGG - Exonic
913956474 1:143301997-143302019 CTCTGCAGATGGCCTGAGATGGG + Intergenic
913959247 1:143326625-143326647 CACTGTGGGTGGCCTGGGACGGG - Intergenic
913980967 1:143513670-143513692 CTCTGCAGATGGCCTGAGATGGG - Intergenic
914053564 1:144152005-144152027 CACTGTGGGTGGCCTGGGACGGG - Intergenic
914075331 1:144340098-144340120 CTCTGCAGATGGCCTGAGATGGG - Intergenic
914103847 1:144626398-144626420 CTCTGCAGATGGCCTGAGATGGG + Intergenic
914125633 1:144814536-144814558 CACTGTGGGTGGCCTGGGACGGG + Intergenic
915128758 1:153682908-153682930 CTCTGCAAGCGAGCAGGGACAGG + Intronic
915338924 1:155165938-155165960 CTCTGCAGGGGGCCAGGGGCAGG - Intergenic
916662553 1:166935814-166935836 CTCTGGAGGCAGCCTAGCACAGG + Intronic
923563691 1:235060851-235060873 CTCTGCAGGTGCCCTGAGGCTGG - Intergenic
1063658395 10:8014435-8014457 CTCTGCAGGGGGCCTGTAAAGGG + Intronic
1065304713 10:24357218-24357240 CTCAGCTGGCTGCCTGGGCCTGG + Intronic
1066781699 10:38955264-38955286 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1067689020 10:48489238-48489260 CTATGAAGACTGCCTGGGACTGG - Intronic
1070395872 10:76010831-76010853 CTCTGCAGAGGGCCTGAGACAGG - Intronic
1071568615 10:86684427-86684449 CTCTGCAGGGGGCCCTGGGCTGG + Intronic
1072252913 10:93595775-93595797 CTCTGCAGGGGGGCTGTCACAGG + Intronic
1072357068 10:94622349-94622371 AGCTGCATGTGGCCTGGGACAGG - Intergenic
1073190040 10:101644574-101644596 CTCTCCAGAGGGCCTGGGGCTGG + Intronic
1075226322 10:120632769-120632791 CTTTGCAGGATGGCTGGGACTGG + Intergenic
1076244510 10:128936023-128936045 CACTGAAGGCAGCCTGGGTCGGG - Intergenic
1076340967 10:129744591-129744613 CTCTGCAGGCAGCCTTTGCCAGG - Intronic
1076424989 10:130361420-130361442 CTCTGCAGGAGGTTAGGGACAGG + Intergenic
1076433233 10:130422213-130422235 CTCTGCTGGGGGCTGGGGACAGG - Intergenic
1076512848 10:131024790-131024812 CTCTCCTGGGGGCCTGGGCCGGG + Intergenic
1076709093 10:132321304-132321326 CTCTGCAGGTGGGCTGGGCTTGG - Intronic
1076752572 10:132550971-132550993 CTCTGCAGGCCACCTGGAAAGGG + Intronic
1076821124 10:132940109-132940131 CTCTGCATGGGGACAGGGACGGG - Intronic
1076893428 10:133296362-133296384 CTCAGCAGGCAGCCGGGGAGTGG - Intronic
1077529442 11:3088275-3088297 CTCTGCAGGAGGCCTGGGGTCGG + Exonic
1080891015 11:36409317-36409339 ATCTGCAGCCGGCCTGAGACAGG + Intronic
1081617675 11:44600251-44600273 CTCTTCAGTGGGCCTGGGTCTGG - Intronic
1081710478 11:45212644-45212666 TCCTGCAGGCAGCCTGGGCCTGG - Intronic
1083255786 11:61494639-61494661 CTCTGCCGACTGCCTGGGCCTGG - Intergenic
1083285690 11:61657286-61657308 ATCTGCAGGCAGCCTGGGCGTGG + Intergenic
1083959604 11:66007281-66007303 CTCAGCAGGCTGCCGGGGGCAGG - Intergenic
1085174830 11:74476647-74476669 CTCTGTGGGAGGCCCGGGACTGG + Intergenic
1088527114 11:110768898-110768920 CTCTGAAGGCTGAGTGGGACTGG + Intergenic
1088868661 11:113873365-113873387 CTCTGCAGGTGGCCAGGAATCGG + Intronic
1089581164 11:119482764-119482786 GTCTGCCGCCTGCCTGGGACTGG + Intergenic
1091346574 11:134858182-134858204 CACTGACGGCAGCCTGGGACAGG + Intergenic
1092864271 12:12746205-12746227 CACTGCACCCGGCCTGGAACAGG - Intronic
1095248899 12:39955873-39955895 CTCTGGAGGGGGTGTGGGACAGG + Intronic
1103309127 12:119990050-119990072 CGCTGCTGGCGGCCGGGGAGCGG + Exonic
1104328931 12:127826158-127826180 CTCTGCAGGCAGCAGAGGACTGG - Intergenic
1106561102 13:30846982-30847004 CTCTGCAGGAGGACGGGGAAGGG + Intergenic
1107016895 13:35714726-35714748 CTCTGCAGCGGGACAGGGACAGG + Intergenic
1107339488 13:39390704-39390726 CTCTGCACCCGGCCTTGGATTGG - Intronic
1107630154 13:42334579-42334601 CTCTGCTGTCTGCCTGGCACAGG - Intergenic
1108247507 13:48532771-48532793 CTCTGCCTGCGGCCTGGGCTGGG + Intronic
1110267335 13:73553243-73553265 CTCTTCAGATGGCCTGGCACAGG + Intergenic
1114665047 14:24372709-24372731 CCCTGCAGGCAGCCTGGGGGAGG + Intronic
1118737375 14:68711686-68711708 CTCAGCAGCTGGGCTGGGACAGG - Intronic
1119570029 14:75661681-75661703 CTCTGCAGGCAGCCTAGGAGAGG + Intronic
1120939823 14:89936963-89936985 CTCTGGAGGCGGGGTGGGAGGGG - Intronic
1122318533 14:100839727-100839749 GTCTGCAGGGCTCCTGGGACAGG - Intergenic
1122440994 14:101731708-101731730 CTCTGAAAGCAGCCTGGGAGGGG + Intronic
1122814119 14:104303929-104303951 CTCTGCAAGCTGCCCGGGTCTGG + Intergenic
1123110571 14:105865114-105865136 GTCTGCAGCCGGCCTGGGTCTGG - Intergenic
1123121412 14:105918663-105918685 CACTGCAGGCTGGCTGGGTCTGG + Intronic
1202929178 14_KI270725v1_random:23562-23584 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1202938889 14_KI270725v1_random:123673-123695 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1123394249 15:19912604-19912626 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1123423120 15:20147658-20147680 CACTGCGGGTGGCCTGGGACGGG - Intergenic
1123532345 15:21154197-21154219 CACTGCGGGTGGCCTGGGACGGG - Intergenic
1125728531 15:41880394-41880416 CTCTGCTGGTGGGCTGGGATGGG - Intronic
1128260885 15:66232121-66232143 CTCGGCAGGCAGCCTAGGCCAGG + Intronic
1129230142 15:74192539-74192561 CTCAGCAGAGGGGCTGGGACCGG - Intronic
1129323490 15:74787518-74787540 CTCAGCAGGCCCCCAGGGACTGG + Intronic
1129669735 15:77600736-77600758 CTCTGCAGCGGGGCTGGGAAAGG - Intergenic
1129842605 15:78753018-78753040 CACAGCAGGTGGCCTGGGGCAGG - Intergenic
1129885321 15:79032951-79032973 GTCAGCAGCCGGCCTGGGGCTGG + Intronic
1131463774 15:92638445-92638467 CTCTGTAGGCTGCCAGGGCCTGG - Intronic
1131463881 15:92639066-92639088 CTCTGCTTGCTTCCTGGGACAGG - Intronic
1132043805 15:98547827-98547849 CTCTGGAGGCGGGGTGGGGCCGG + Intergenic
1132222971 15:100118643-100118665 CTCCCCAGGCAGCCTGGGCCAGG + Intronic
1132374680 15:101321165-101321187 TTCCGCTGGCGGCCTGGGAGAGG - Intronic
1132768289 16:1546262-1546284 TTCTGCAGGCAGCCTAGGCCGGG + Intronic
1133094723 16:3435369-3435391 CACTGCAGGCAGCCAGGGAAAGG - Exonic
1133220696 16:4317988-4318010 CTCCCCAGGGGGCCTGGGCCAGG - Intronic
1133272278 16:4616104-4616126 CTCTGGACGGCGCCTGGGACAGG + Intergenic
1135132215 16:19862257-19862279 CTCTGCAGGCCGCGGGTGACAGG + Intronic
1135327833 16:21538586-21538608 CGCTGCAGCCGTCCAGGGACTGG + Intergenic
1136338186 16:29624611-29624633 CGCTGCAGCCGTCCAGGGACTGG + Intergenic
1136700269 16:32130493-32130515 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1136767383 16:32796971-32796993 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1136800765 16:33073730-33073752 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1136861633 16:33707685-33707707 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1136863641 16:33722137-33722159 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1137290290 16:47047931-47047953 CTCTTCAGCCGGCCTGGGGAGGG + Intergenic
1137476933 16:48817367-48817389 CTCTGCAGGCTGGCTGGGAGTGG - Intergenic
1137725002 16:50651042-50651064 CTCTGCAGGAGGCCCAGGAGGGG - Intergenic
1137753867 16:50886283-50886305 CTCAGCAGGTGACCTGGGAGTGG - Intergenic
1138591146 16:58000400-58000422 CCCTGCAGGCGGCCTGGAGCAGG - Intronic
1141106942 16:81241707-81241729 CTCTGCAGGCTGCCTGGCCTTGG - Intronic
1141438258 16:84013171-84013193 CTCTCCAGGGGGCCTGAGCCAGG - Intronic
1141876753 16:86830178-86830200 CTCTGCTGGTGGCATGGGAGGGG + Intergenic
1142029573 16:87831812-87831834 CTCTGCAGGCGGGTGGGGACTGG + Exonic
1142190580 16:88715490-88715512 CACAGCTGGCGGCCTTGGACGGG + Exonic
1203069776 16_KI270728v1_random:1058993-1059015 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1203123129 16_KI270728v1_random:1555869-1555891 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1142638294 17:1271012-1271034 CCCTGCAGGCGGCGGGGGGCTGG - Exonic
1142812174 17:2400528-2400550 CTCCGCAGGCCGCCCGGGAGGGG + Intronic
1143350238 17:6282770-6282792 CTCTGCAGGCCACCAGGCACTGG + Intergenic
1143560015 17:7688181-7688203 CTCTGCAGGCGGCGGGGGGGCGG + Exonic
1143615060 17:8044808-8044830 CTCTGCAGGGGGTGGGGGACAGG - Exonic
1144020948 17:11240257-11240279 CTCTGCAGCCGGCCCGCGGCAGG - Intergenic
1144473314 17:15563367-15563389 CTCTGCAGGTTCCGTGGGACTGG - Intronic
1144923168 17:18781353-18781375 CTCTGCAGGTTCCGTGGGACTGG + Intronic
1144951912 17:18998930-18998952 CTCTGGAGGAGGGCTGGGACGGG - Intronic
1145324476 17:21791382-21791404 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1145326128 17:21827427-21827449 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1145689182 17:26716911-26716933 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1145710957 17:26975702-26975724 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1145994923 17:29099669-29099691 CCCTGCAGGCTGCTTGGAACAGG + Exonic
1147563196 17:41521365-41521387 CTGGGCAGGCTGCCTGGGGCAGG - Exonic
1147980091 17:44268828-44268850 CTCTGTAGGCAGCCTGGCTCAGG + Intergenic
1148047454 17:44752997-44753019 CTTGGGAGGGGGCCTGGGACAGG - Intergenic
1148555777 17:48577908-48577930 CTTTGCACGCGGAGTGGGACGGG + Exonic
1151192284 17:72407258-72407280 CTCTGCAGATGAACTGGGACAGG + Intergenic
1151457575 17:74235488-74235510 TTCTGCAGGCACCCTGGGTCTGG + Intronic
1151555139 17:74842918-74842940 TGCTGCACGCGGCCTGGGCCCGG - Exonic
1151742840 17:75995650-75995672 CTCTGGAGTAGGCCTGGGAAAGG - Intronic
1152462510 17:80448988-80449010 CTGGGAAAGCGGCCTGGGACAGG + Intergenic
1203182372 17_KI270729v1_random:72558-72580 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1153618019 18:6952007-6952029 ATCTGCATGTGGACTGGGACAGG - Intronic
1154012042 18:10582560-10582582 CTGTGCATGGGGCCTGGGAGAGG + Intergenic
1154516873 18:15179755-15179777 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1155231419 18:23778701-23778723 CTCTGCTGGCGCCCTGGGGTAGG - Intronic
1155967289 18:32048121-32048143 CACTGCACCCGGCCTGAGACAGG - Intronic
1156271718 18:35541047-35541069 CTCTGCAGGCAGGCTGGGTGAGG - Intergenic
1157559586 18:48637123-48637145 ATCTGCAGAAGGCCTGGGAGGGG + Intronic
1159085367 18:63783708-63783730 CTCTGCATGCAGCCTGGACCTGG - Intronic
1160936322 19:1597425-1597447 CTCTGCACGTGGGCTGGGCCTGG + Exonic
1161008338 19:1947695-1947717 GCCTGCAGGTGGGCTGGGACAGG + Intronic
1161160076 19:2756994-2757016 TTCTGCAGGCGGCCTTAGGCAGG + Intronic
1161541843 19:4856585-4856607 CCCAGCAGGCAGCCTGGCACAGG - Intronic
1162492470 19:11001610-11001632 CTCTGCAGGCTGCCTCAGTCAGG - Intronic
1163090984 19:15020457-15020479 CTCGGCAGGAGGCCAGGGTCTGG - Exonic
1163267074 19:16227886-16227908 CTCTGGGGGCTGCCTGGGAAAGG - Intronic
1163419047 19:17203988-17204010 CTCTGGAGGCTGCCTGGGCTTGG - Intronic
1163716762 19:18877460-18877482 CACTGCAGCCGGCCTGAGTCGGG - Intronic
1164756275 19:30691994-30692016 CTCTGCAGGCGGTCATGGCCGGG + Intronic
1164977015 19:32581110-32581132 CTCTGCCGGCGCCCTGGCAGCGG + Exonic
1165094060 19:33401064-33401086 CTGTGCAGGCTGCCTGGGGTTGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1167530023 19:50009430-50009452 CTCTGCAGGCACCATTGGACTGG + Intronic
1202668558 1_KI270709v1_random:24480-24502 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1202692961 1_KI270712v1_random:104426-104448 CACTGTGGGTGGCCTGGGACGGG - Intergenic
925158772 2:1667039-1667061 CCCTGCAGGTGGGCTGGGCCAGG - Intronic
926717776 2:15938882-15938904 CTCTGTAGGCGTCCAGGGTCAGG + Intergenic
926799132 2:16643682-16643704 CTCTGCAGGCTTCCAGGGCCAGG + Intronic
927030329 2:19114812-19114834 CTCTGCAGCAGCCTTGGGACTGG + Intergenic
927860708 2:26558414-26558436 CTCTGGAGGTGGCCGGGGATAGG - Intronic
927897209 2:26790809-26790831 CTCTGCTGGCTGCCTGGCACAGG + Intronic
928815792 2:35293106-35293128 CTTTGCAGGAGGACTGGGAGGGG - Intergenic
930900850 2:56506311-56506333 CCCTGAAGTAGGCCTGGGACTGG + Intergenic
931808462 2:65830691-65830713 CTCTTGAGGCTGCCTGGGAATGG - Intergenic
932947760 2:76257128-76257150 TTCTCCAGGTGGCCTTGGACTGG - Intergenic
933953437 2:87349536-87349558 CACTGTGGGTGGCCTGGGACGGG + Intergenic
934237643 2:90245785-90245807 CACTGTGGGTGGCCTGGGACGGG + Intergenic
934252746 2:90375416-90375438 CTCTGCAGATGGCCTGAGATGGG + Intergenic
934256694 2:91427531-91427553 CTCTGCAGATGGCCTGAGATGGG - Intergenic
934275557 2:91570945-91570967 CACTGTGGGTGGCCTGGGACGGG - Intergenic
934460082 2:94209124-94209146 CACTGCTGGTGGCCTGGGACGGG + Intergenic
934616568 2:95774915-95774937 CTCTGCAGGCCGCCTGGTACAGG + Intergenic
934644324 2:96049644-96049666 CTCTGCAGGCCGCCTGGTACAGG - Intergenic
934837740 2:97605734-97605756 CTCTGCAGGCCGCCTGGTACAGG - Intergenic
934952131 2:98583920-98583942 CACTGCAGGCTCCCTGGGGCAGG + Intronic
935666691 2:105518538-105518560 GTCTGCAGGCGGGGTGGGGCAGG + Intergenic
935820146 2:106886399-106886421 TCCCGCAGGCCGCCTGGGACGGG - Exonic
935925559 2:108065003-108065025 CTCTGCATGAGGCTAGGGACTGG + Intergenic
936165360 2:110115651-110115673 CTCTGCAGGTGGCCCGGGTCGGG + Intronic
937924066 2:127154178-127154200 CTCTTCAGGCAGCCAGGGTCAGG + Intergenic
938069189 2:128299649-128299671 TTCTGCCGGGGGCCTGGCACAGG - Intronic
938517197 2:132024725-132024747 CTCTGCAGATGGCCTGAGATGGG + Intergenic
942505561 2:176638010-176638032 CTCAGCGAGCGCCCTGGGACTGG - Intergenic
946442622 2:219709671-219709693 CTCTGCATGAAGCCTGGGTCAGG + Intergenic
948495417 2:238345650-238345672 CTGTGGAGGCGCCCTGGGAGGGG + Intronic
948627249 2:239276734-239276756 CTCTGCAGCCGGCCTTTGTCTGG - Intronic
1169021114 20:2331909-2331931 CTGGACAGGCGGCCTAGGACTGG - Intronic
1169199917 20:3703903-3703925 CGCTCCAGGCTGCCTGGGGCAGG + Exonic
1169860805 20:10150501-10150523 CTCTGCAGGAGGCATGGTGCTGG + Intergenic
1170678330 20:18502744-18502766 TTCTCCAGACGGCCTTGGACTGG + Intergenic
1170714870 20:18822986-18823008 ATCTGCAGGCGGCCCTGGAATGG + Intronic
1170839184 20:19909842-19909864 CTCAGCAGGCAGCCTGGGTGTGG + Intronic
1170907786 20:20531344-20531366 CTCTTCAGCAGGCCTGGGAGAGG - Intronic
1171342782 20:24443733-24443755 CCCAGCAGGCAGCCTGGGCCTGG + Intergenic
1173504404 20:43575638-43575660 CTAAGCAGGCAGCCTAGGACTGG - Intronic
1173575852 20:44112660-44112682 ACCTGCAGGAGGCCTGGGGCCGG - Exonic
1175285227 20:57833328-57833350 CTTTGCAGGTGGCTGGGGACTGG + Intergenic
1175768312 20:61606432-61606454 CTCTGGAGTCAGCCTGGGTCTGG - Intronic
1175813784 20:61873143-61873165 ATCTGGGGGCGCCCTGGGACTGG - Intronic
1175952648 20:62591538-62591560 CTCTGGTGGGGGCCTGGGGCTGG - Intergenic
1176205875 20:63887864-63887886 CACTGCAGGCAGCCAGGGTCAGG - Intronic
1176584366 21:8563856-8563878 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1176591202 21:8652160-8652182 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1177172164 21:17666968-17666990 CTCTGAAAGCTGGCTGGGACCGG + Intergenic
1179010585 21:37553042-37553064 CCCTCGAGGCGGCCTGGGCCTGG + Intergenic
1179126788 21:38598196-38598218 CTCTGCAGCCTGACAGGGACTGG - Intronic
1179218334 21:39385909-39385931 CTGTGCAGGCGCCCTAGGACTGG + Intronic
1179553897 21:42160401-42160423 CTCTGCAGGCGCCGTGGCAGGGG + Intergenic
1179829689 21:43988901-43988923 CACTGCAGGCGGCCTGCACCTGG + Intergenic
1180267178 22:10540760-10540782 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1180274048 22:10629271-10629293 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1180660461 22:17462625-17462647 CACTGCAGCTGGCCTAGGACAGG - Intronic
1181021458 22:20105676-20105698 CTCTGCTGGCCACCTGGGGCTGG + Intronic
1181031959 22:20152608-20152630 CCCTGCAGGAGGCCTGGGCTGGG + Intergenic
1181356183 22:22297638-22297660 CACTGCGGGTGGCCTGGGACCGG - Intergenic
1182489924 22:30664766-30664788 CTCTGAAGAAGGCCTGGGAAAGG + Intronic
1183338462 22:37264691-37264713 GTCAGGAGGCAGCCTGGGACTGG + Intergenic
1183627683 22:39014592-39014614 CTCAGCAGGCGGACTGGGCTGGG - Intronic
1183633618 22:39047722-39047744 CTCAGCAGGGGGCCTGGGCTGGG - Intronic
1184032035 22:41900837-41900859 CTCTGCAGGCAGCCTTGGAGTGG + Intronic
1184581651 22:45422080-45422102 CTATGCTGGGGTCCTGGGACAGG - Intronic
1184650673 22:45918216-45918238 CTCTGCAGGGGGACGGGGAGGGG + Intergenic
1184692389 22:46123186-46123208 CTCTGCAGGCGGCCCTGGTGGGG - Intergenic
1184975024 22:48054980-48055002 GTCTCCAGCCGGCCAGGGACCGG - Intergenic
1185005730 22:48275744-48275766 CTCTCCAGCCTGCCTGGGCCAGG - Intergenic
1185281509 22:49971894-49971916 CCCCGCAGCCCGCCTGGGACCGG - Intergenic
1203288253 22_KI270735v1_random:4988-5010 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1203326082 22_KI270738v1_random:20893-20915 CTCTGCAGATGGCCTGAGATGGG + Intergenic
950417726 3:12877887-12877909 GCCTGCAGGCCGCCTGTGACTGG + Intergenic
953717333 3:45326714-45326736 ATCTGAAAGCGGCCTGGGAGTGG + Intergenic
954333540 3:49903441-49903463 CTCCGCCGGAGGCCTGGTACAGG - Exonic
954375977 3:50194326-50194348 CTCCTCAGGCCGCCCGGGACAGG - Intronic
954647768 3:52141973-52141995 CTCTTCAGGCTCCCTGGGAGAGG - Intronic
954691478 3:52397850-52397872 TTCTGCAGGCAGCCAGGGCCGGG + Exonic
956739737 3:72266493-72266515 CTCTGGAGGCAGGCTGGGAAGGG + Intergenic
961182603 3:124887793-124887815 CACTGCCGGCGGCCTGAGATGGG + Intronic
961658769 3:128457411-128457433 CTCTGCACTGGGCCTGGGGCAGG - Intergenic
963875013 3:150465777-150465799 CTCTCCATCCTGCCTGGGACAGG + Exonic
966815677 3:183887891-183887913 CCCTGAAGGCTGCCTGGGTCTGG - Intergenic
968655485 4:1776751-1776773 CTGTGCAGGTGGCCTGGGCCTGG + Intergenic
968728109 4:2257548-2257570 CTTCCCAGGCGGCCAGGGACTGG + Intronic
968835522 4:2961873-2961895 CTGTGCTGAAGGCCTGGGACGGG - Intronic
968913240 4:3486215-3486237 CTCTGCAGGAGTCCTTGGCCAGG + Intronic
969716472 4:8870567-8870589 CGCTGCAGACAGCCTGGGGCAGG - Intronic
970008180 4:11429486-11429508 CTCTGCAGCCGGACTGGGACCGG + Exonic
971244610 4:24916970-24916992 CTCTGCAGGAGGCCTGGCTGTGG - Intronic
973531868 4:51843428-51843450 CGCTGCGGGCGGCGTGGGGCGGG + Intronic
974754630 4:66187266-66187288 CACTGGTGGCAGCCTGGGACTGG + Intergenic
975177065 4:71300717-71300739 TTCTGGAGGGGGCCTGGGAAGGG + Intronic
978916035 4:114127183-114127205 CCCTGCAGGCCCCATGGGACAGG + Intergenic
980012736 4:127614956-127614978 TTCTCCAGGTGGCCTTGGACTGG - Intergenic
985665443 5:1179595-1179617 CGCTCCAGGCAGCCTGGGCCTGG + Intergenic
985808600 5:2067023-2067045 TTCTGCAGGCTGCATGGGGCCGG - Intergenic
986845603 5:11749136-11749158 ATCTGAAGCAGGCCTGGGACTGG - Intronic
997661138 5:135590388-135590410 CCCTGCAGGCTGGCTGGGGCCGG - Intergenic
999298139 5:150473293-150473315 CTATCCAGGCAGGCTGGGACTGG - Intergenic
999466944 5:151816289-151816311 CTCAGCAGAAGGCCTGGGATGGG + Intergenic
999616255 5:153427728-153427750 CACTGGAGGGGGTCTGGGACAGG + Intergenic
1001590231 5:172859728-172859750 CTCCGCAGGTGCCCTTGGACAGG + Intronic
1001592791 5:172877912-172877934 CCCTGCAGCCAGCCTGGGGCTGG + Intronic
1002487668 5:179550702-179550724 CTCCGCAGGTCGCCTGGGCCGGG - Exonic
1003418922 6:5938488-5938510 CTCTGCAGGTGGTGTGGGATTGG - Intergenic
1007109769 6:39306330-39306352 CACCGCACCCGGCCTGGGACTGG + Intronic
1007229555 6:40338744-40338766 CCCTGCAGGTGGCCTGGGGCAGG + Intergenic
1007687647 6:43676517-43676539 CCCACCAGGCTGCCTGGGACAGG + Intronic
1010302599 6:74279639-74279661 CTCTGCTGACATCCTGGGACAGG - Intergenic
1014778071 6:125533543-125533565 CTCTGGAGGTGGCCTGGGGCAGG - Intergenic
1015235613 6:130967493-130967515 CTCTGCTGGAGGGCTGGGAATGG + Intronic
1015366386 6:132401576-132401598 CCCTGCAGGCGGCCCGGGGCGGG - Intergenic
1017645813 6:156539102-156539124 CTCTGCTGGAGGTCTGGGAGTGG - Intergenic
1018853972 6:167662619-167662641 CTCTGCCCGCGGCCTGGCGCAGG + Intergenic
1019016690 6:168885320-168885342 CTCTGCAGGCCTCCTGGGCCTGG - Intergenic
1019178781 6:170174851-170174873 CCCAGGAGGAGGCCTGGGACAGG - Intergenic
1019279570 7:193042-193064 CCCTGCACGCGGCCCGGGCCCGG + Exonic
1019290627 7:248423-248445 CTCTCCAGGTAGCCTGGCACGGG + Exonic
1019290637 7:248459-248481 CTCTCCAGGTAGCCTGGCACGGG + Intronic
1019290647 7:248495-248517 CTCTCCAGGTAGCCTGGCACGGG + Intronic
1019290667 7:248568-248590 CTCTCCAGGTAGCCTGGCACGGG + Intronic
1019290677 7:248604-248626 CTCTTCAGGTAGCCTGGCACGGG + Intronic
1019290696 7:248677-248699 CTCTCCAGGTAGCCTGGCACGGG + Intronic
1019651840 7:2163766-2163788 CCCTGGAGGCAGCCTGGGCCTGG + Intronic
1020036239 7:4964806-4964828 CTTTGCCGGCGGCCTGGGGGTGG + Intergenic
1020274388 7:6615724-6615746 GCCTGCGGGCGGCCTGGGCCGGG - Exonic
1020916443 7:14199504-14199526 CTCTGCAGGCGGCCTGGGACAGG + Intronic
1021413508 7:20355167-20355189 GGCTGCAGGCAGCCTGGTACGGG - Intronic
1022286324 7:28958212-28958234 CTCTGCAGGCGGGCTTCGCCCGG + Exonic
1024208199 7:47181765-47181787 CTCTGGGGCCGGGCTGGGACAGG - Intergenic
1024569022 7:50709227-50709249 CTCAGCACAGGGCCTGGGACTGG - Intronic
1024807491 7:53162204-53162226 CTCTGCAGGTGGCCTGACATGGG + Intergenic
1025306288 7:57861630-57861652 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1025319069 7:58072009-58072031 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1025477479 7:60942489-60942511 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1025482905 7:61006743-61006765 CTCTGCAGTTGGCCTGAGATGGG - Intergenic
1025554649 7:62291175-62291197 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1025560132 7:62362101-62362123 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1025562991 7:62393672-62393694 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1025877314 7:65494965-65494987 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1026925464 7:74189375-74189397 CTCTGCAGATGGCCTGAGAAAGG + Intronic
1029127051 7:98301753-98301775 CTGTGGAGGCAGCCGGGGACTGG + Intronic
1032151776 7:129435040-129435062 CGCCGCAGGCAGCCTGGGAGGGG - Intronic
1033327747 7:140393412-140393434 CTCACCAGGCGGCCTGGCAAAGG - Intronic
1033540277 7:142349823-142349845 CTCTGCAGTCGGTCTCGGCCAGG + Intergenic
1033597558 7:142867992-142868014 CTCAGGAAGCGGCGTGGGACTGG + Exonic
1034412249 7:150947673-150947695 CTCTCCGGGGGGCCTGGGGCTGG + Exonic
1034973635 7:155435537-155435559 CTCTGCATTTGGCCTGGGATGGG - Intergenic
1035273350 7:157732989-157733011 CTGTGCTGGGCGCCTGGGACGGG - Intronic
1035273377 7:157733115-157733137 CTGTGCTGGGCGCCTGGGACGGG - Intronic
1035273384 7:157733147-157733169 CTGTGCTGGGCGCCTGGGACGGG - Intronic
1035273511 7:157733751-157733773 CTGTGCTGGGCGCCTGGGACGGG - Intronic
1035273597 7:157734133-157734155 CTGTGCTGGGCGCCTGGGACGGG - Intronic
1035662194 8:1356499-1356521 CTGTGCTGGTGGCCTGGGATGGG + Intergenic
1036212650 8:6854681-6854703 CTCTGCAGCCGGCTCTGGACTGG - Intergenic
1036381281 8:8237906-8237928 TCCTGCAGGAGGCCTGGGCCTGG - Intergenic
1036794933 8:11748981-11749003 CTCTGGAGGCGAGATGGGACGGG + Exonic
1039716458 8:40114688-40114710 CACTTTAGGAGGCCTGGGACGGG - Intergenic
1040330436 8:46383087-46383109 CTTTACAGCCTGCCTGGGACAGG - Intergenic
1040330726 8:46384464-46384486 CTTTGCAGCCAGCCTTGGACAGG - Intergenic
1040339958 8:46435452-46435474 CTTTACAGCCTGCCTGGGACAGG + Intergenic
1040531887 8:48272581-48272603 CCCTGCAGGTGGCCTGGAGCAGG + Intergenic
1042028845 8:64452079-64452101 CTCTGCAGGCTGCCTGCAGCTGG - Intergenic
1047732091 8:127736314-127736336 CGCTGCGGGCGTCCTGGGAAGGG + Exonic
1048381773 8:133871711-133871733 CTCTGAAGGAGGCCAGGGAGGGG + Intergenic
1048823393 8:138400013-138400035 CTCTGCAGGGGGCCTGGGACTGG - Intronic
1048835235 8:138513004-138513026 CTCTGCTGAAGGCCGGGGACAGG + Intergenic
1049266164 8:141668932-141668954 CCCTGCAGAGGGCCTGGCACAGG - Intergenic
1049308135 8:141918588-141918610 CTCTGCAGGGGGCTGGGCACGGG + Intergenic
1049324643 8:142015632-142015654 CACAGCAGGCGGCCTGGCCCTGG - Intergenic
1049349679 8:142157815-142157837 CCCTGGAGGCGACCTGAGACGGG + Intergenic
1049388535 8:142356353-142356375 CTCTGCACGCTGCCTGGAATGGG + Intronic
1049405772 8:142451266-142451288 CTCTTCAGGCTGCCGGGGAGTGG - Intronic
1049709535 8:144057378-144057400 CTGAGCAGGAGGCCTGGGGCAGG + Intronic
1049746680 8:144266046-144266068 CCCTGCACACGGCCTGGCACAGG + Intronic
1049776786 8:144409605-144409627 CCCTGCAGCCGTCCTGGGTCTGG - Intergenic
1050382437 9:5043151-5043173 GTCTGCGGGCGGCCCTGGACTGG + Intronic
1052903662 9:33816750-33816772 CTCCGCAGCCATCCTGGGACGGG - Intergenic
1052968961 9:34364780-34364802 CATTGCAGGAAGCCTGGGACTGG - Intergenic
1054274240 9:63052692-63052714 CACTGCTGGTGGCCTGGGACGGG - Intergenic
1054301832 9:63385774-63385796 CACTGCTGGTGGCCTGGGACGGG + Intergenic
1054400601 9:64712277-64712299 CACTGCTGGTGGCCTGGGACGGG + Intergenic
1054434207 9:65196592-65196614 CACTGCTGGTGGCCTGGGACGGG + Intergenic
1054496182 9:65825088-65825110 CACTGCTGGTGGCCTGGGACGGG - Intergenic
1055182323 9:73402807-73402829 CCTTGCAGGCGGACTGGGAGGGG - Intergenic
1057575007 9:96235401-96235423 CTCTTCAGCCAGCATGGGACTGG + Exonic
1061023616 9:128033163-128033185 CACTGCACCCGGCCTGAGACAGG + Intergenic
1061194557 9:129100688-129100710 GTCTGCAGGTGGCATGGGGCGGG + Exonic
1061242457 9:129382532-129382554 CTCTGAAGGAGGCCTGAGCCAGG - Intergenic
1061242635 9:129383375-129383397 CTCTGCAGGTAGCCCGGGCCTGG + Intergenic
1061653432 9:132069253-132069275 CTCTGCAGCCTCCCTGGGGCCGG + Intronic
1061925688 9:133805076-133805098 CTGTCCAGGCAGCCGGGGACAGG - Intronic
1062030041 9:134358133-134358155 CTCGGCAGGTGGCCGGGGCCTGG - Intronic
1062137165 9:134935308-134935330 CTCTCCAGCCTCCCTGGGACTGG + Intergenic
1062210365 9:135360311-135360333 CTGTGGAGGGGGCCTGGGAAAGG - Intergenic
1062222188 9:135422684-135422706 CCCTGGAGGCTGCCTGGGAGCGG + Intergenic
1203614270 Un_KI270749v1:41386-41408 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1203621227 Un_KI270749v1:130925-130947 CACTGCGGGTGGCCTGGGACGGG + Intergenic
1186406778 X:9311534-9311556 CTCTCCAGTGGGCCTGGAACAGG - Intergenic
1190127911 X:47722534-47722556 CTCTGCAAGTGTCCTGGTACAGG - Intergenic
1190966673 X:55307606-55307628 CTCTGCATGGGGACTGGGAGTGG + Intergenic
1192189777 X:68983729-68983751 CTGTGCAGGCTGCCAGGGCCAGG + Intergenic
1195707203 X:107746176-107746198 GACTGCAGGTGGCCTGGGAGAGG + Intronic
1196069695 X:111507146-111507168 CTCTGCAGAAGGTCTGGGATAGG + Intergenic
1197009592 X:121544969-121544991 CTTTGCAGGCTGACTGGGAGGGG + Intergenic
1197845830 X:130801408-130801430 CTCTGCAGGCAACATGGTACAGG - Intronic
1199265417 X:145821499-145821521 CTTTGCAGGCTCCCCGGGACAGG - Exonic
1200251215 X:154555026-154555048 CTCTGCTGACTGCCTGGCACTGG + Intronic
1202584435 Y:26408782-26408804 CACTGCGGGTGGCCTGGGACGGG - Intergenic