ID: 1020924385

View in Genome Browser
Species Human (GRCh38)
Location 7:14306651-14306673
Sequence GCCTCTTAAAAGAAAACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020924385_1020924386 -8 Left 1020924385 7:14306651-14306673 CCATGGGTTTTCTTTTAAGAGGC 0: 1
1: 0
2: 1
3: 28
4: 306
Right 1020924386 7:14306666-14306688 TAAGAGGCGTAATGTTGTGCTGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020924385 Original CRISPR GCCTCTTAAAAGAAAACCCA TGG (reversed) Intronic
901558774 1:10052974-10052996 CCCTTATAAAAGAAAGCCCAGGG - Intronic
903689773 1:25164703-25164725 AACTCTTAAAAGAAAACATAAGG + Intergenic
905052436 1:35063308-35063330 GTCTCTTAAAACAAAACAAAAGG - Intronic
905560637 1:38924292-38924314 TACTCTTAAAAGGAAACACAGGG + Intronic
906639383 1:47432628-47432650 GCCTCATAGAAGCAAAGCCAGGG - Intergenic
907067886 1:51503993-51504015 AACTCTTAAAAGAAAACACAGGG + Intronic
907849411 1:58240064-58240086 CCATCTTACAAGCAAACCCAGGG + Intronic
909481170 1:76130100-76130122 GCCTCTTAAATAAGAACACAAGG - Intronic
909712350 1:78666320-78666342 GGCTCCTATCAGAAAACCCAAGG - Intergenic
909929768 1:81483271-81483293 GCCATTTAAAACAAAAACCACGG + Intronic
910014737 1:82507695-82507717 TCCTCTTAAAACAAAACCATTGG - Intergenic
910182387 1:84499813-84499835 TCCTCTTAAAAGGAAATACAGGG + Intronic
912663389 1:111555804-111555826 ACCTCTTAGAAGAAAACATAAGG + Intronic
913659064 1:120990757-120990779 TAGCCTTAAAAGAAAACCCAGGG - Intergenic
914990627 1:152496832-152496854 GAATCTTAAAAGAAAACTCAAGG - Intergenic
915078627 1:153335087-153335109 AAATCTTAGAAGAAAACCCAGGG + Intronic
916311150 1:163400157-163400179 GGCTCATAAAAGAAGCCCCATGG - Intergenic
916483001 1:165232381-165232403 GCCTCTTGAAGGGAAAACCAGGG + Intronic
916515904 1:165516409-165516431 GTCTCTTAAAAGAAAAAAGAAGG + Intergenic
917232081 1:172848276-172848298 GACTCTGAAAAGAAAAACAAAGG + Intergenic
918805504 1:189036389-189036411 GATTCTGAAAAGAAAACCAAAGG - Intergenic
919615932 1:199808659-199808681 GCCTCTTTGATGAAATCCCAAGG - Intergenic
919616856 1:199818743-199818765 ACATATTAAAAGAAAAGCCAAGG + Intergenic
920168208 1:204051362-204051384 GCCTCTAAAAAAAAAAACCAGGG - Intergenic
920170173 1:204067138-204067160 GCCTCTGAGAAGAAGCCCCACGG + Intergenic
920840418 1:209549371-209549393 CCCTCTTAAAAAAAAGACCAGGG + Intergenic
924032701 1:239902713-239902735 GGTTCTTAGAAGGAAACCCAAGG + Intronic
924220647 1:241871885-241871907 GCCTCAGAAAAGAAAACATAAGG - Intronic
924316601 1:242804035-242804057 GTCTCTTAGAAGAGAAACCAAGG + Intergenic
924713869 1:246554216-246554238 AACTCTTAGAAGAAAACACAAGG + Intronic
1065179793 10:23113384-23113406 GCAGATTAAAAAAAAACCCATGG - Intronic
1065652641 10:27909514-27909536 GTGTCTTAAAAGAAGACTCAGGG + Intronic
1066384076 10:34927268-34927290 AACTCTTAAAAGAAAACATAGGG + Intergenic
1067353430 10:45499534-45499556 AATTCTTAAAAGAAAACCTAGGG - Intronic
1067435967 10:46278110-46278132 TCTTCTCAAAAGAAAACGCAAGG - Intergenic
1067823955 10:49556138-49556160 AACTCTTAGAAGAAAACCTAGGG + Intergenic
1069031528 10:63601416-63601438 TCCACAAAAAAGAAAACCCATGG + Intronic
1069575279 10:69523017-69523039 AACTCTTAGAAGAAAACACAGGG - Intergenic
1069588507 10:69627361-69627383 GCCTCTTCAGAGAAAACACTGGG - Intergenic
1071742064 10:88370145-88370167 ACCTCTTAAAACCAAATCCATGG + Intronic
1072030023 10:91510130-91510152 GCCTCTTAGAATAAAGTCCATGG + Intronic
1072890527 10:99319767-99319789 GCCTCTTAACAGGATACACATGG - Intergenic
1073821616 10:107270907-107270929 CCCTCATAAAAGAGACCCCAGGG - Intergenic
1075398908 10:122147734-122147756 CACTCTTAAAAGAAAGCCCAAGG - Intronic
1075867153 10:125733357-125733379 GCAGTTTAAGAGAAAACCCAAGG - Intronic
1076034470 10:127187571-127187593 GCCACGTAGAAGAAAATCCAGGG + Intronic
1076366423 10:129923687-129923709 AACTCTTAAAAGAAAACAGAGGG + Intronic
1077653143 11:3992719-3992741 AACTCTTAGAAGAAAACACAGGG - Intronic
1079694437 11:23461939-23461961 TCCTCTTACCAGAAAACTCATGG + Intergenic
1079994767 11:27284352-27284374 GTATCTCAATAGAAAACCCAAGG - Intergenic
1082023042 11:47551203-47551225 ACCCCTTTAAAGAAAACCCAGGG - Intronic
1082288114 11:50338468-50338490 CCCTCATAAAAGAGACCCCAGGG + Intergenic
1082893905 11:58169915-58169937 GTCTCTTAAAAGAGAATCCATGG - Intronic
1085006723 11:73098804-73098826 AACTCTTAAAGGAAAACACAGGG + Intronic
1086164259 11:83759446-83759468 GCTAATTAAAAGAAAGCCCAAGG - Intronic
1087429072 11:98028312-98028334 GCCTTTTACAAGAAAACCCATGG - Intergenic
1089048865 11:115528460-115528482 GCCTCTGGGAATAAAACCCAGGG + Intergenic
1089776693 11:120842576-120842598 TCCTCTAAAAAGACAAGCCAGGG - Intronic
1090170570 11:124599897-124599919 AACTCTTAGAAGAAAACGCAGGG - Intergenic
1090981625 11:131727428-131727450 CCCTTTTAATTGAAAACCCAGGG - Intronic
1091040273 11:132271989-132272011 AACTCTTAGAAGAAAACACAGGG - Intronic
1093377990 12:18454955-18454977 GCCTCTTGAGAGAAAAACCCTGG - Intronic
1094209697 12:27876215-27876237 GACTCTTAGAAGAAAACACAGGG - Intergenic
1094755011 12:33457907-33457929 GTCTCATAAAACAAAAGCCAAGG + Intergenic
1095766076 12:45897281-45897303 GACTCTTAGAAGAAAACACAGGG + Intronic
1096737032 12:53663729-53663751 GCATCTAGAGAGAAAACCCAAGG - Intronic
1098061001 12:66562397-66562419 GCAGCTTGAAAGAAAATCCAAGG - Intronic
1100129467 12:91473578-91473600 GGCTTTTAAAAGAAAACATAAGG - Intergenic
1101567728 12:105924479-105924501 TACTCTTAAAAGAAAAGCAAGGG - Intergenic
1102390699 12:112546573-112546595 GTCTCTTAAAAGAAAAGAAAAGG - Intergenic
1104379391 12:128293822-128293844 GGCAATTAAAATAAAACCCAGGG - Intronic
1105903793 13:24782998-24783020 AACTCTTAAAAGAAAACACAGGG - Intronic
1106147523 13:27063474-27063496 TACTCTTAGAAGAAAACACAGGG + Intergenic
1106559779 13:30838308-30838330 GCCCCTCAAAAGAAATCCCTGGG + Intergenic
1106780423 13:33053746-33053768 GCCTATGAAGAGAAAAACCATGG - Exonic
1106932950 13:34686585-34686607 CCCTCTTAAATGAAAACCTGAGG - Intergenic
1109515727 13:63440660-63440682 CCCTATTAAAAGAGACCCCAAGG - Intergenic
1110932817 13:81244117-81244139 AACTCATATAAGAAAACCCAAGG - Intergenic
1112142463 13:96660569-96660591 AACTCCTAAAAGAAAACACAGGG + Intronic
1112668573 13:101607985-101608007 GTCTGATAAAAGAAAACCAAAGG - Intronic
1112897155 13:104313549-104313571 GCCTGATAAAAGACAAGCCATGG + Intergenic
1113237287 13:108293020-108293042 GACTCTTAGAAGAAAACATATGG - Intronic
1113302055 13:109033104-109033126 GCCTCTGAATAGCAAAACCATGG - Intronic
1113511771 13:110861890-110861912 AACTCTTAGAAGAAAACACACGG - Intergenic
1113530816 13:111024790-111024812 GACTCTTAGAAGGAAACACAGGG + Intergenic
1115047360 14:29012602-29012624 AACTCCTAAAAGAAAACACAGGG + Intergenic
1115050130 14:29049826-29049848 GCATCTTAAAGGAAAACCTAAGG - Intergenic
1115660428 14:35489040-35489062 GACTCTTACAAGAAAACAAAAGG - Intergenic
1117059243 14:51944693-51944715 AACTCTTAAAAGAAAACATAGGG + Intronic
1117376245 14:55120837-55120859 CACTCTTAAGAGAGAACCCAGGG - Intergenic
1118050233 14:62018609-62018631 GCATTTTAGAAGAAGACCCAAGG - Intronic
1119029046 14:71177107-71177129 GCCTCAAAAAAGAAAACTCTTGG - Intergenic
1119837829 14:77766780-77766802 AACTCTTAGAAGAAAACACAGGG + Intronic
1120584826 14:86299234-86299256 GCCTATTTGAAGAAAATCCAGGG + Intergenic
1123018339 14:105386070-105386092 ACTTCTTAAATCAAAACCCAGGG - Intronic
1123480126 15:20623311-20623333 CCATCTTCAAAGAAGACCCAGGG - Intergenic
1123637881 15:22377053-22377075 CCATCTTCAAAGAAGACCCAGGG + Intergenic
1123785506 15:23667372-23667394 AACTTTTAAAAGAAAACACAGGG - Intergenic
1124105529 15:26734341-26734363 GACTCTTAGAAGAAAACACAGGG + Intronic
1124450799 15:29788406-29788428 ACCTCTTTGAAGAAAACACAGGG - Intronic
1126495794 15:49289451-49289473 CCCTCTTACCAGAAGACCCAGGG + Intronic
1128887068 15:71298043-71298065 AACTCTTAGAAGAAAACACAAGG - Intronic
1133186363 16:4101901-4101923 GCCTCTTTACTGAAAACCCTCGG - Intronic
1133542698 16:6771891-6771913 GCCCCTTCAAAGAACACCAAAGG - Intronic
1134930427 16:18202872-18202894 ACTCCTTAAAAGAAAAGCCATGG - Intergenic
1135434371 16:22416286-22416308 GCCTTTTAAAAGATAACCCTGGG + Intronic
1137227660 16:46530369-46530391 GACTCTTAAAAAAAAGCCCATGG + Intergenic
1137470899 16:48757528-48757550 AAATCTTAAAAGAAAACACAGGG - Intergenic
1139837348 16:69849803-69849825 GTCTCTTAAAAAAAAAATCATGG + Intronic
1140431157 16:74905073-74905095 AGCTTTTAAAAGAAAACACAAGG + Intronic
1141944615 16:87300874-87300896 CACTCTTAGAAGAAAACACAAGG + Intronic
1142726387 17:1817742-1817764 ACTTCTTAAAAGAAAACATAGGG - Intronic
1146149915 17:30458557-30458579 AACTCTTCAAAGAAAACACAAGG - Intronic
1148962091 17:51401824-51401846 GCCTCTTAAAGGAGAACCTGGGG + Intergenic
1149264038 17:54908250-54908272 GCCTATTTAAAGAAAATCCAAGG - Intronic
1149808088 17:59638331-59638353 GTCTCTTAAAAAAAAACAGAAGG + Intronic
1150559949 17:66285979-66286001 AACTTTTAAAAGAAAACTCAAGG - Intergenic
1150952210 17:69816099-69816121 ACATTTTAAAAGAAAGCCCAAGG - Intergenic
1151427899 17:74043155-74043177 GCCTCTAAGAAGAACATCCAGGG - Intergenic
1151504460 17:74517544-74517566 AACTCTTAGAAGAAAACACAAGG + Intergenic
1151946997 17:77325240-77325262 AACTCTTAGAAGAAAACACAGGG - Intronic
1153418140 18:4873083-4873105 GACTCTTAGAAGAAAACATATGG + Intergenic
1153754768 18:8269924-8269946 AACTCTTAGAAGAAAACCTAGGG + Intronic
1154236887 18:12614456-12614478 GCTTATTAAAATAAAAACCAGGG - Intronic
1156080504 18:33328403-33328425 AACTCTTAAAAGAAAACCTATGG - Intronic
1157382990 18:47236580-47236602 CCCTTATAAAAGAAACCCCAGGG + Intronic
1157754649 18:50206981-50207003 GCCTCTTAAAAAGAAATACAAGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1161010515 19:1957481-1957503 CCCTCCTAACAGCAAACCCAAGG - Intronic
1162347322 19:10126969-10126991 GTCTCTAAAAAGAAAAGACAAGG + Intergenic
1163056396 19:14722698-14722720 GACTCTTAGAAGAAAACATAGGG - Intronic
1163295497 19:16409387-16409409 AACTCTTAGAAGAAAACACAGGG + Intronic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1163588823 19:18178981-18179003 GCCTTTTAAAAGAAAAAGAAGGG + Intergenic
1164612521 19:29642429-29642451 GCCTCTTCATGGAAACCCCAGGG + Intergenic
1164837374 19:31365708-31365730 GCCTTTTAAAACAAAACAGAAGG + Intergenic
1166437735 19:42783466-42783488 GACTCTTAGAAGAAAACATAAGG + Intronic
1166456684 19:42947263-42947285 GACTCTTAGAAGAAAACATAAGG + Intronic
1166466640 19:43038128-43038150 GACTCTTAGAAGAAAACATAAGG + Intronic
1166493548 19:43281185-43281207 GACTCTTAGAAGAAAACATAAGG + Intergenic
1202646951 1_KI270706v1_random:151824-151846 AACTCTTAGAAGAAAACACATGG + Intergenic
925377322 2:3396973-3396995 GCCTCTTTAAAGAAAAAAAAAGG + Intronic
925685558 2:6469066-6469088 TCCTCACAAAGGAAAACCCAAGG - Intergenic
925905426 2:8537116-8537138 GCTTCTTTCAGGAAAACCCAGGG - Intergenic
926786057 2:16519430-16519452 CCCTGTTAAAAGAAAGCCAAAGG - Intergenic
927592334 2:24367122-24367144 GCCCTTTAAAAGAGACCCCAGGG - Intergenic
931482350 2:62654268-62654290 GCTTCTTAAGAGAAAAGGCAGGG + Intergenic
931933109 2:67163433-67163455 AACTCTTAAAAGAACACTCATGG + Intergenic
933253700 2:80057133-80057155 GCTTTTTAAAAGTAAATCCATGG + Intronic
935865710 2:107385458-107385480 ACTTCTCAAAGGAAAACCCATGG - Intergenic
936684373 2:114810783-114810805 GAGTCTTAGAGGAAAACCCAAGG - Intronic
937195096 2:120147340-120147362 GCCCCTTAGAAAAAAAACCAGGG - Intronic
937469289 2:122161471-122161493 GCCACTTAGAAAAAAACACATGG - Intergenic
938548290 2:132354294-132354316 AACTCTTAGAAGAAAACACACGG - Intergenic
938844297 2:135192923-135192945 AACTCTTAGAAGAAAACACAGGG + Intronic
940053598 2:149490150-149490172 TCCTCATAAAAAAAAATCCAAGG - Intergenic
940621253 2:156116765-156116787 GTATCTTAATAGAAAACTCAAGG - Intergenic
941288416 2:163644011-163644033 TTCTCTTAGAAGAAAACACAGGG + Intronic
942870110 2:180724577-180724599 GGCACTGAAAAGAAAACACAGGG - Intergenic
943313852 2:186361041-186361063 CCCTAATAAAAGAGAACCCAGGG + Intergenic
944197979 2:197075307-197075329 GGCTCTGAAAAGAAAAATCAAGG - Intronic
945974559 2:216260059-216260081 GCACCACAAAAGAAAACCCATGG + Intronic
948068411 2:235100200-235100222 GCCTTTTAAAAAATAAACCAAGG - Intergenic
948125227 2:235560084-235560106 AACTCTTAGAAGAAAACACAAGG - Intronic
1168818703 20:759158-759180 ACCTCTAAAAAGAAGTCCCAGGG + Intergenic
1169450657 20:5707929-5707951 GTCTCTTAAAAAACAAACCAAGG - Intergenic
1169909514 20:10636211-10636233 GCCCCTTTAAAGAGAGCCCAGGG + Intronic
1172106512 20:32520317-32520339 GCCTCTGATAAGTAAACCCACGG - Intronic
1172111610 20:32549003-32549025 AACTCTTAGAAGAAAACACAGGG + Intronic
1174409811 20:50327781-50327803 AACTTTTAAAAGAAAACCAAAGG + Intergenic
1174711932 20:52715783-52715805 GCCTCTGAAGAGAAAACCTCTGG - Intergenic
1175647169 20:60684606-60684628 GCCTCCCAACAGCAAACCCAAGG - Intergenic
1176176200 20:63726491-63726513 GCCTATTAAAAAAAAATTCAAGG - Intronic
1176604917 21:8820950-8820972 AACTCTTAGAAGAAAACACACGG - Intergenic
1177717822 21:24863032-24863054 TCCTCATAAAAGAAAACAGAGGG + Intergenic
1178394550 21:32230773-32230795 AACTCTTACAAGAAAACACAGGG + Intergenic
1180347207 22:11712555-11712577 AACTCTTAGAAGAAAACACACGG - Intergenic
1180354960 22:11830645-11830667 AACTCTTAGAAGAAAACACACGG - Intergenic
1180383292 22:12161686-12161708 AACTCTTAGAAGAAAACACACGG + Intergenic
1184707989 22:46228531-46228553 GTCTCAAAAAAGAAAAACCAAGG + Intronic
1184920795 22:47604421-47604443 GCCTTTTAAAATATTACCCAGGG - Intergenic
949781329 3:7691957-7691979 GCCAGTTAAAATAAAACACAGGG - Intronic
949907798 3:8873171-8873193 GCCTCTTAAAAAAAAAGTGATGG + Intronic
950272543 3:11629892-11629914 GCCTGTTAAAATAAAGCTCAAGG - Intronic
950367005 3:12493923-12493945 ACCTCTTAAAAGAAAACACCAGG - Intronic
950538492 3:13595470-13595492 TCCTCATAAAAAAAAACTCAAGG + Intronic
950616363 3:14162660-14162682 ATCTCTTACAAGAAAACACAGGG + Intronic
950696907 3:14708122-14708144 ACCTCTTAGAAGAAAACACAGGG - Intronic
950826446 3:15827632-15827654 AACTCTTAGAAGAAAACACAGGG + Intronic
950935034 3:16830508-16830530 AACTTTTAGAAGAAAACCCAGGG + Intronic
951749603 3:26019724-26019746 GCTTTTCAAAAGAAGACCCACGG + Intergenic
955543536 3:60003080-60003102 GCATTTTAAAAGAAAAACCAAGG - Intronic
955744718 3:62128823-62128845 GCCACTTAAAAAAAAATTCATGG - Intronic
955830831 3:63001801-63001823 GCCTCTTACTACAAAACCCAAGG + Intergenic
958840699 3:99200987-99201009 GTCACTTAAAAGAAAAGCAATGG + Intergenic
960336928 3:116428794-116428816 GCTTCTTAAAAGATAATGCAAGG - Intronic
960983904 3:123258904-123258926 GTCTCTGAAAAGAAAACTAATGG - Intronic
962470112 3:135699308-135699330 GCCTCTTCAAATATAAACCATGG - Intergenic
962480635 3:135795198-135795220 TCCTTTTGAAAGAAAACACAAGG - Intergenic
962555564 3:136547814-136547836 GACTCTTAGAAGAAAACATAGGG - Intronic
964163897 3:153678062-153678084 GCCTCTGAAACGAAATGCCAGGG - Intergenic
965221240 3:165929454-165929476 GTCTCTTAGAATAAAACACAGGG + Intergenic
966314453 3:178630132-178630154 GTCTCTTAAAAGAAGCGCCAGGG - Intronic
966409532 3:179634028-179634050 GCCTCTTAAAAAAAAAGTGAAGG + Intergenic
966973116 3:185063248-185063270 ACCTGTCAAAAGAAAACACAGGG + Intergenic
967356173 3:188574146-188574168 GCCACTGAAGAGGAAACCCAGGG - Intronic
967453887 3:189658567-189658589 GATTTTTAAAAGAAAACCAAGGG - Intronic
968020206 3:195379196-195379218 AACTCTTAGAAGAAAACCTAAGG + Intronic
969055576 4:4400073-4400095 AACTCTTAGAAGAAAACACAAGG - Intronic
970096688 4:12471626-12471648 TCCTCTTAAAAGAGGTCCCAGGG - Intergenic
970497608 4:16642680-16642702 GGCTCTTGAAAGGAAGCCCATGG + Intronic
971599586 4:28575349-28575371 CCCTTATAAAAGAAAACCAAGGG - Intergenic
971663476 4:29451332-29451354 ACCTCCTAAAAGAAAACATAGGG + Intergenic
973373204 4:49269985-49270007 AACTCTTAGAAGAAAACACACGG + Intergenic
973387801 4:49525222-49525244 AACTCTTAGAAGAAAACACACGG - Intergenic
974489045 4:62540474-62540496 GACTATTAAAAGAACAACCAAGG + Intergenic
975187255 4:71418691-71418713 GTGTCATAAAAGAAAACCCCTGG - Intronic
976710232 4:88062799-88062821 GCCTCTTAAAACAAAGTCCTTGG + Intronic
977984193 4:103362215-103362237 GCATCTTAAAAGGAATTCCAGGG + Intergenic
978212952 4:106160168-106160190 GACTCTTAGAAGAAAACATAGGG + Intronic
979234065 4:118379388-118379410 GCTTTTTAAAAAAAAATCCAGGG - Intergenic
980069830 4:128232160-128232182 AACTCTTAGAAGAAAACCTAGGG + Intergenic
980101578 4:128546713-128546735 GCCTCTGAAAAAGAAATCCAAGG - Intergenic
981268670 4:142818373-142818395 GCCTCTGAGAGAAAAACCCATGG - Intronic
982534543 4:156593283-156593305 ACCTCTGAATAGACAACCCATGG - Intergenic
984636267 4:182113217-182113239 GTCTATTAAAAGAAAACAAACGG - Intergenic
988451738 5:31350772-31350794 GCTTCATTAAAGAAAAACCAGGG - Intergenic
989200140 5:38754978-38755000 TCCTCTTTAAAGAAAAAACATGG - Intergenic
989384074 5:40837269-40837291 ACCTCTTTAAAGAAAGCCAAGGG - Intergenic
989554644 5:42779156-42779178 ACCTGTAAAAAGAAAACCTAGGG - Intronic
991345392 5:65660636-65660658 ATCTTTTAAAAGAAAAACCATGG - Intronic
992063835 5:73085472-73085494 GCCTTTGAAAAGAATATCCAAGG + Intronic
992111826 5:73501638-73501660 GCCTGTTCAAAGAATAGCCAAGG + Intronic
993142249 5:84049897-84049919 ACCTCTTAAAAAAAATCACACGG + Intronic
994940757 5:106320972-106320994 GCCTCTGTAAAGAAAACAAAAGG + Intergenic
998656486 5:144186569-144186591 ACCTCTTAAAAGAAAGCAGAAGG + Intronic
1000620915 5:163485746-163485768 ATCTCTTAGAAGAAAACACAGGG - Intronic
1001061529 5:168494282-168494304 GCCTCTTAACAGAAAACAGAAGG - Intronic
1001735675 5:173997378-173997400 AACTGTTAGAAGAAAACCCAAGG - Intronic
1002688478 5:181034157-181034179 GTCTCTTTAAAAAAAAGCCAAGG + Intergenic
1004240477 6:13916742-13916764 GCCTCTAATAAGAAGAGCCATGG - Intergenic
1004440644 6:15648939-15648961 AACTCTTAGAAGAAAACACAGGG + Intronic
1004654157 6:17642124-17642146 AACTCTTAGAAGAAAACCTAGGG + Intronic
1004968819 6:20885547-20885569 GACTCTTAGAAGAAAACACAGGG + Intronic
1005358203 6:25005233-25005255 GCCTCGTAGATGAAAACCCCAGG - Intronic
1007418064 6:41703527-41703549 GACTCTTAAAAACAAAGCCAGGG - Intronic
1008878965 6:56361314-56361336 GTCTCATAAAAGAATAACCAGGG + Intronic
1009042451 6:58195427-58195449 GCCTCTTTTAAGAAAAACTAAGG + Intergenic
1009218296 6:60949649-60949671 GCCTCTTTTAAGAAAAACTAAGG + Intergenic
1009244266 6:61216049-61216071 GCCTCTTAAAACTAAACCAATGG - Intergenic
1012177520 6:96106736-96106758 GCCTGTTACAAGAAAAGTCATGG + Intronic
1012548005 6:100441322-100441344 GCCTCTGAATAGAACCCCCAGGG + Intronic
1012752239 6:103178586-103178608 GCCACTAAAGAGGAAACCCAGGG - Intergenic
1014664549 6:124220776-124220798 GCCTCTTTAAATAAAACTAAAGG - Intronic
1014884600 6:126764500-126764522 GGCAAATAAAAGAAAACCCAGGG + Intergenic
1015311069 6:131767866-131767888 GCAACTGAAAAGAAAACCCCAGG - Intergenic
1015506177 6:133991223-133991245 GCCTCAAAAAAGAAAACCCCAGG - Exonic
1018333911 6:162763962-162763984 CCATTTTAAAAGAAAATCCAAGG - Intronic
1018785192 6:167102755-167102777 GCCTCCAGAATGAAAACCCAAGG - Intergenic
1020843313 7:13249483-13249505 AACTCTTAAAAGAAAACATAAGG - Intergenic
1020924385 7:14306651-14306673 GCCTCTTAAAAGAAAACCCATGG - Intronic
1021481964 7:21128202-21128224 TCCCCTTAACATAAAACCCAGGG + Intergenic
1021562613 7:21983809-21983831 AACTCTTAGAAGAAAACACAGGG + Intergenic
1023018765 7:35990972-35990994 AACTCTTAGAAGAAAACACAGGG + Intergenic
1025195810 7:56931889-56931911 ACCTCTTAAAAGAAAACATAGGG - Intergenic
1025676139 7:63645046-63645068 ACCTCTTAAAAGAAAACATAGGG + Intergenic
1027709817 7:81586229-81586251 GTCTATGAAAATAAAACCCATGG - Intergenic
1029066478 7:97854563-97854585 GCCTCTAAAAATATTACCCATGG + Exonic
1030026634 7:105330539-105330561 GACTCTTCCTAGAAAACCCAAGG + Intronic
1031244916 7:119299256-119299278 GCCTCTTAAAAATAAAACAAAGG - Intergenic
1031384153 7:121125801-121125823 GCATCTAAAATGAAAACACAAGG - Exonic
1032269444 7:130390049-130390071 GTCTCTTAAAAGAAAAAAAAAGG + Intergenic
1033020315 7:137718205-137718227 GTTTCTTAAAAGCAAACCCTAGG + Intronic
1033078122 7:138268403-138268425 GACACTAAAAATAAAACCCATGG + Intergenic
1034840858 7:154394689-154394711 AACTCTTAAAAGAAAAGACAGGG - Intronic
1035175743 7:157049365-157049387 GTATCTTTAAAGAAAACACAAGG - Intergenic
1035315319 7:157993868-157993890 GCCTCGGAAGACAAAACCCAAGG + Intronic
1036666489 8:10746573-10746595 TACTCTTAGAAGAAAACACAGGG - Intronic
1037955478 8:23054315-23054337 GCCTCTGAAAAGCAAAACAAAGG - Intronic
1038944887 8:32347915-32347937 GCCTTTTCAAAGAAAGGCCACGG + Intronic
1040717238 8:50271936-50271958 CCCTCATAAAAGAGACCCCAGGG + Intronic
1042297092 8:67232351-67232373 GTTTTCTAAAAGAAAACCCATGG - Intronic
1042674150 8:71300687-71300709 GCTTCTAATAAGAAAACCTAGGG + Intronic
1042770773 8:72379456-72379478 GCATCCTAGAAGAAAAACCAAGG + Intergenic
1043439172 8:80261537-80261559 GTCACATAAAAGAAAAACCAAGG - Intergenic
1045040982 8:98224281-98224303 ATCTCTGAAAAGAAAACCCCAGG - Intronic
1047277129 8:123414724-123414746 GCCTCTTGACACAAAAACCAGGG - Intronic
1047279619 8:123433746-123433768 CCCTTTTAAAAGACAACCAAAGG - Intronic
1049991331 9:994559-994581 AGATCTAAAAAGAAAACCCAAGG - Intergenic
1050966752 9:11813878-11813900 AACTAATAAAAGAAAACCCAGGG - Intergenic
1052396085 9:27940018-27940040 GTCTCAGAAATGAAAACCCAAGG - Intergenic
1052886190 9:33650410-33650432 GGCTCCTAAAAGAACTCCCACGG - Intergenic
1053522581 9:38795600-38795622 AACTCTTAGAAGAAAACCTATGG - Intergenic
1053752594 9:41272391-41272413 AACTCTTAGAAGAAAACACAAGG + Intergenic
1054194810 9:62020021-62020043 AACTCTTAGAAGAAAACCTATGG - Intergenic
1054258122 9:62836743-62836765 AACTCTTAGAAGAAAACACAAGG + Intergenic
1054351680 9:64022052-64022074 AACTCTTAGAAGAAAACACACGG - Intergenic
1054643598 9:67568669-67568691 AACTCTTAGAAGAAAACCTATGG + Intergenic
1055902566 9:81257968-81257990 GCCACTGAAGAGAAAACCTAAGG - Intergenic
1057385239 9:94600795-94600817 GCCCATAAAAAGAAAACCCAAGG + Intergenic
1057685084 9:97225376-97225398 AACTCTTAGAAGAAAACACAAGG + Intergenic
1058258148 9:102795437-102795459 GCCATTTAAAAGAAAGCCCTAGG - Intergenic
1058957283 9:109960772-109960794 GCCTGGTAAGAGAAGACCCATGG - Intronic
1060187708 9:121574095-121574117 GCCTCTCAAAGGAAGGCCCAGGG - Intronic
1061611877 9:131752233-131752255 GCCTCTTCAAAAAAAACAAAGGG - Intergenic
1062429277 9:136519819-136519841 ACCTCTTAAAAGAGACCCAAGGG - Intronic
1062602767 9:137326096-137326118 GACTCTTAGAAGAAGACACAGGG + Intronic
1062667774 9:137686307-137686329 AACTCTTACAAGAAAACACAGGG - Intronic
1202800657 9_KI270719v1_random:171633-171655 AACTCTTAGAAGAAAACACAAGG - Intergenic
1203696916 Un_GL000214v1:107990-108012 AACTCTTAGAAGAAAACACACGG + Intergenic
1203552299 Un_KI270743v1:173041-173063 AACTCTTAGAAGAAAACACACGG - Intergenic
1186541232 X:10402551-10402573 AACTCTTAGAAGAAAACACAGGG - Intergenic
1187417328 X:19104506-19104528 GCCCCTCAGAAGAAACCCCATGG + Intronic
1188163578 X:26832610-26832632 GTCTCTATAAAGAAAACACAGGG - Intergenic
1188856731 X:35205738-35205760 GGCTCTTTAAAGAAATGCCACGG + Intergenic
1189335302 X:40167563-40167585 GTTTCTAAAAAGAAAACCCGTGG + Intronic
1190802945 X:53809091-53809113 ACCTCTCAAAAGAAAACCTCAGG + Intergenic
1190993324 X:55576840-55576862 AACTATTAAAAGAAAACCTAAGG + Intergenic
1191664834 X:63690499-63690521 GTCTCATCAAAGAAAAGCCAAGG + Intronic
1191883771 X:65868105-65868127 AACTCTTAAAAGAAAATACACGG + Intergenic
1191885434 X:65883257-65883279 GCCTCCTAAAGAAAAATCCAAGG + Intergenic
1192108507 X:68340596-68340618 TACTCTTAAAAGAAAACATAGGG + Intronic
1194141434 X:90215029-90215051 ATCTCCTAAAAGAAAACACAAGG + Intergenic
1194832426 X:98640552-98640574 AGCTCTTAGAAGAAAACACAGGG + Intergenic
1194913547 X:99676629-99676651 TCTTCTGAAAAGAAAAACCATGG - Intergenic
1195352957 X:104011958-104011980 TCCTCTGAAAAGAAAAGCAATGG + Intronic
1195363742 X:104108154-104108176 GCATCTTAACAGAAAATACATGG - Intronic
1195493299 X:105499281-105499303 AACTCCTAAAAGAAAACACAGGG + Intronic
1195771958 X:108360857-108360879 ACTTCTTAAAAGAAAACCCCCGG - Intronic
1196914861 X:120522336-120522358 AACTCTTATAAGAAAACACAGGG + Intergenic
1197493610 X:127150667-127150689 AACTCTTAAAAGAAAACATAGGG - Intergenic
1198390792 X:136171787-136171809 GTGCTTTAAAAGAAAACCCAAGG - Intronic
1200487188 Y:3784133-3784155 ATCTCCTAAAAGAAAACACAAGG + Intergenic
1201220110 Y:11760579-11760601 GTCTCTTAGAAGAGAAACCAAGG + Intergenic
1202340581 Y:23860766-23860788 GCTACTAAAAAGAAAACCCCAGG - Intergenic
1202530185 Y:25809316-25809338 GCTACTAAAAAGAAAACCCCAGG + Intergenic