ID: 1020927381

View in Genome Browser
Species Human (GRCh38)
Location 7:14348165-14348187
Sequence TGTCGAAGGAAAGGAGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 661
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 603}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020927381_1020927387 25 Left 1020927381 7:14348165-14348187 CCACTCCCTCCTTTCCTTCGACA 0: 1
1: 0
2: 2
3: 55
4: 603
Right 1020927387 7:14348213-14348235 TAATTTTGTTATTTCAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020927381 Original CRISPR TGTCGAAGGAAAGGAGGGAG TGG (reversed) Intronic
900113432 1:1019292-1019314 TGAAGATTGAAAGGAGGGAGCGG - Intergenic
900471891 1:2859184-2859206 GGAGGAAGGAAGGGAGGGAGGGG + Intergenic
900840038 1:5041422-5041444 TGTCCCAGGAAAGGAAGAAGTGG - Intergenic
901309438 1:8257730-8257752 TGGGGCAGGAGAGGAGGGAGAGG + Intergenic
901328091 1:8381242-8381264 AGTCGGAGGAAAGGGAGGAGGGG - Intronic
901635295 1:10667639-10667661 TGGGGAAGGGAAGGGGGGAGTGG + Intronic
901656572 1:10773016-10773038 TTCCCAAGGAAAGGAAGGAGGGG + Intronic
901757304 1:11449179-11449201 TCTCCAAGGCAAGGCGGGAGCGG - Intergenic
902101260 1:13991758-13991780 TGTTGAAGGAAAGGAGGGCAGGG - Intergenic
902443705 1:16448172-16448194 TGTCCAGGGAAAGAAGGGAGGGG - Intronic
902503805 1:16926708-16926730 TGGGAATGGAAAGGAGGGAGTGG + Intronic
902753493 1:18533914-18533936 TGTGGGAGGAAAGGAGGGGCGGG - Intergenic
903098055 1:20999387-20999409 TGTGGTATGAAAGTAGGGAGTGG + Intronic
903806769 1:26011191-26011213 TGTCAAAGCCAAGGAGAGAGTGG + Intergenic
904213231 1:28899435-28899457 TGTCCCAGGAAAGGGGGAAGAGG - Intronic
904257794 1:29267405-29267427 TGAAGAAGAAAAGCAGGGAGTGG + Intronic
904267104 1:29324441-29324463 AGTCACAGGGAAGGAGGGAGAGG + Intronic
904577006 1:31511358-31511380 TGGGGAGGGAGAGGAGGGAGGGG + Intergenic
904591775 1:31619022-31619044 GGAGGAAGGAAAGGAGGGAGTGG - Exonic
904838416 1:33354568-33354590 TGTCAAAGGACAGGACAGAGAGG + Intronic
905245001 1:36606657-36606679 GCTCGAAGGAGAGGAGGGTGAGG + Intergenic
905272348 1:36795283-36795305 TGTGGATGGAGATGAGGGAGGGG + Intergenic
906153720 1:43602161-43602183 GCTAGCAGGAAAGGAGGGAGAGG - Intronic
906482687 1:46209862-46209884 AAAGGAAGGAAAGGAGGGAGGGG + Intronic
907234966 1:53038366-53038388 GGTGGAAGGGAAGGAGGGACAGG - Intronic
908145077 1:61233107-61233129 TGTGAAAGGCAAGGAGGGAGGGG - Intronic
909588089 1:77313591-77313613 TGGTGATGGAAAGGAGAGAGAGG - Intronic
910245328 1:85132666-85132688 TGTGCTGGGAAAGGAGGGAGTGG - Intronic
910566520 1:88649576-88649598 CCTGGAATGAAAGGAGGGAGGGG + Intergenic
911565827 1:99462216-99462238 TGTCCAAGGACAGGAGGAAAAGG + Intergenic
911927559 1:103854111-103854133 ACTCGAAGGAAAGAAGGAAGAGG + Intergenic
912315892 1:108667469-108667491 TGTGGAGGGAGAGGCGGGAGCGG + Intergenic
912346072 1:108964353-108964375 AGTCGCTGGGAAGGAGGGAGGGG - Intergenic
912439886 1:109689812-109689834 AGTTGAAAGGAAGGAGGGAGAGG - Intronic
912443249 1:109714494-109714516 AGTTGAAAGGAAGGAGGGAGAGG - Intronic
913088957 1:115463253-115463275 AATAGAAGGAAAGGAGGAAGAGG + Intergenic
913226854 1:116708159-116708181 TGGAGAAGGTAAGGAGAGAGAGG + Intergenic
913445283 1:118944273-118944295 TGGCCAAGAAAAGGAGGGTGGGG + Intronic
914217886 1:145650132-145650154 TGTCGAAGGCGGGGAGGGGGAGG - Intronic
914323685 1:146590172-146590194 AAACGAAGGAAAGGAGGTAGAGG + Intergenic
914470440 1:147972807-147972829 TGTCGAAGGCGGGGAGGGGGAGG - Intronic
914853811 1:151335399-151335421 TGTGGAAGGAAATGAAGGACTGG - Intergenic
916400240 1:164439962-164439984 AATGGAAGGAAAGGAAGGAGAGG + Intergenic
916752559 1:167736676-167736698 GGACAATGGAAAGGAGGGAGTGG - Intronic
916781423 1:168034503-168034525 TGTCTATGGAAAGGATGGAGTGG + Intronic
917598430 1:176552624-176552646 TGCCCAAGGAATGAAGGGAGAGG - Intronic
918234679 1:182569358-182569380 AGTTGAGGGAAAGGAGGGAGGGG - Intergenic
918595484 1:186287976-186287998 GCTGGAAGGAAAGGAGAGAGAGG - Intergenic
918708904 1:187703613-187703635 TGTGGAGGGAGAGGAGCGAGCGG + Intergenic
918732337 1:188013668-188013690 TGTGGAAGGAGAGGCGCGAGCGG - Intergenic
918887385 1:190212955-190212977 GGACCCAGGAAAGGAGGGAGGGG + Intronic
919560918 1:199116929-199116951 TGTGGTTGGTAAGGAGGGAGAGG - Intergenic
920066465 1:203273128-203273150 CCTAGACGGAAAGGAGGGAGCGG + Intronic
920747170 1:208639868-208639890 TATCCAGGCAAAGGAGGGAGAGG - Intergenic
921186619 1:212675696-212675718 TGTCGAAAGAAGGAAGGGAAGGG + Intergenic
921191234 1:212710458-212710480 TGTCAAAGGGAAGGCTGGAGTGG + Intergenic
922541951 1:226426658-226426680 TGTGGAGGGAGAGGAGTGAGCGG - Intergenic
922580704 1:226695763-226695785 AGAAGAAGGACAGGAGGGAGAGG + Intronic
922855753 1:228773698-228773720 TGTGGAGGGAAAGGTGCGAGCGG + Intergenic
923848293 1:237762590-237762612 TGACGAAGGAAAGGAGGCTGAGG - Intronic
923964755 1:239125112-239125134 CGTGGAAAGACAGGAGGGAGAGG + Intergenic
924482511 1:244450311-244450333 GCTGGAAGGGAAGGAGGGAGAGG + Intronic
924548391 1:245051497-245051519 TGAGGAGGGAAGGGAGGGAGTGG + Intronic
924686287 1:246294144-246294166 GGTGGAAGGAATGTAGGGAGAGG - Intronic
1063921551 10:10938699-10938721 AGTCTAAGGACATGAGGGAGGGG + Intergenic
1064481167 10:15742252-15742274 TGTTGGAGGATGGGAGGGAGAGG - Intergenic
1064949183 10:20827927-20827949 TGAAGAAGGAGGGGAGGGAGAGG + Intronic
1065198107 10:23286490-23286512 GGAAGAAGGAAGGGAGGGAGGGG + Intronic
1065939752 10:30553652-30553674 TGTGAAAAGATAGGAGGGAGGGG - Intergenic
1066293586 10:34035387-34035409 TGTGGAGGGAGAGGCGGGAGTGG + Intergenic
1066390747 10:34975940-34975962 TGGAGAGGGAGAGGAGGGAGAGG - Intergenic
1067267934 10:44763352-44763374 TGGGGAAAGAAAGGAGGAAGGGG + Intergenic
1067324350 10:45252664-45252686 TGTTGGATGAAAGTAGGGAGTGG - Intergenic
1067807884 10:49405823-49405845 AGAGGAAGGGAAGGAGGGAGTGG - Intergenic
1069646772 10:70005322-70005344 GAACGAAGGAAGGGAGGGAGAGG + Intergenic
1069882642 10:71603288-71603310 TGTCCCAGGGAAGGAGGGGGAGG - Intronic
1070385256 10:75918395-75918417 GGTGGAAGGCAAAGAGGGAGCGG + Intronic
1070766822 10:79061583-79061605 TGAAGAAGGAAAGCAGGGGGTGG + Intergenic
1070956868 10:80469665-80469687 TGTCAAAAGAGAGGAGGAAGAGG - Intronic
1072639065 10:97197144-97197166 TGACGAAGGGAGGGAGGGAGTGG - Intronic
1073426631 10:103459063-103459085 TGTGGGAGGGAGGGAGGGAGGGG + Intergenic
1073511539 10:104045688-104045710 TGTGGAAGGAAGGGATGGACAGG - Intronic
1073610276 10:104936332-104936354 TGTAGAAGGAAGGTATGGAGGGG + Intronic
1074264679 10:111889764-111889786 TGGGGAAGGAAAGAGGGGAGAGG - Intergenic
1074444883 10:113513449-113513471 TGTGGAAGGAGAGAAGGAAGTGG - Intergenic
1075009621 10:118856505-118856527 TGTCCAAGGAGAGGACAGAGTGG + Intergenic
1075345594 10:121679754-121679776 GGTAGAAGGAAGGCAGGGAGAGG - Intergenic
1075475751 10:122732103-122732125 TGACGTAGGTAAGGAGGGTGAGG - Intergenic
1075792275 10:125093599-125093621 TGTCGAAAGAAGGGAGGGGGTGG - Intronic
1076378223 10:130006719-130006741 GGAGGAGGGAAAGGAGGGAGGGG + Intergenic
1076516169 10:131045532-131045554 GGGAGGAGGAAAGGAGGGAGAGG + Intergenic
1077213110 11:1382624-1382646 TGACGAAGGCAGGGCGGGAGTGG + Intergenic
1078775962 11:14393844-14393866 TGTATAGGGAAAGGAGGGAGGGG - Intergenic
1078807928 11:14725448-14725470 AGAGGGAGGAAAGGAGGGAGGGG - Intronic
1079093794 11:17498127-17498149 TGAGGGAGGAAAGGAGGGAGGGG + Intronic
1079117887 11:17652152-17652174 TGTCGAGGGAGAGGAGGAAAAGG - Intergenic
1079134653 11:17769539-17769561 TGGTGAAAGAAAGGAGGGATAGG + Intronic
1079934550 11:26600575-26600597 AGAGGAAGGAAGGGAGGGAGAGG - Intronic
1079934556 11:26600593-26600615 AGAAGAAGGAATGGAGGGAGAGG - Intronic
1080517176 11:33035267-33035289 GGTGGAAGGAGAGGAAGGAGAGG - Intergenic
1081035753 11:38143826-38143848 TAGAGAAGGAAAGTAGGGAGAGG - Intergenic
1082132378 11:48506249-48506271 TGTGGAAGGGAAGGGGGAAGGGG - Intergenic
1082244425 11:49905177-49905199 TGTGGAAGGGAAGGGGGAAGGGG + Intergenic
1082565841 11:54676869-54676891 TGTGGAAGGGAAGGGGGAAGGGG - Intergenic
1082665617 11:55972105-55972127 TGGAGAATGAAAGGAGGGAGAGG + Intergenic
1082786941 11:57322465-57322487 TGTGGAAGGAGAACAGGGAGAGG - Intronic
1083729080 11:64643332-64643354 GGCCGGGGGAAAGGAGGGAGCGG + Intronic
1084495548 11:69501127-69501149 GATGGAAAGAAAGGAGGGAGGGG + Intergenic
1084546372 11:69817108-69817130 TCCAGAAGGAAAGGCGGGAGGGG - Intronic
1084742760 11:71150079-71150101 AGAGGAAGGAAGGGAGGGAGAGG + Intronic
1084757536 11:71249274-71249296 TGTGGAAGAAAGGGAAGGAGAGG - Intronic
1084803248 11:71560515-71560537 GGAGGGAGGAAAGGAGGGAGGGG - Intronic
1086098469 11:83073083-83073105 TGTCTCAGAAAAGGCGGGAGGGG + Intergenic
1086611611 11:88763025-88763047 TGGAGCGGGAAAGGAGGGAGAGG + Intronic
1086898441 11:92339781-92339803 TGTCGCTGGAAAGCAGAGAGTGG + Intergenic
1087171136 11:95050999-95051021 TGTCGAGGGATAGCAGGCAGGGG - Intergenic
1088462497 11:110095782-110095804 CCTGGAAGGAAAGCAGGGAGTGG + Intronic
1088470497 11:110184087-110184109 TGTAGAATAACAGGAGGGAGAGG + Intronic
1089391480 11:118104867-118104889 GGAGGAAGGAAAGGAGGAAGAGG - Intronic
1089493467 11:118897335-118897357 GGATGAAGGAAAGGAGGAAGAGG - Exonic
1089774613 11:120827472-120827494 TCTGGAAGGAGAGGAGGGTGGGG + Intronic
1090579933 11:128148648-128148670 TGTTGATGGGAAGGAAGGAGGGG - Intergenic
1091134230 11:133173930-133173952 TGTAGAATGGATGGAGGGAGAGG - Intronic
1091523569 12:1273068-1273090 TCCAGAAGGAAGGGAGGGAGGGG + Intronic
1091607936 12:1972825-1972847 TGAGGAAGGGAGGGAGGGAGAGG + Intronic
1091822331 12:3485002-3485024 TCTGGAAGGAAAGGAAAGAGAGG + Intronic
1092651775 12:10642494-10642516 TGAAGAAGGAAGGGAGGAAGAGG - Intronic
1092737366 12:11595202-11595224 TGTGGCAGGAAAGGATGGAGCGG - Intergenic
1093205095 12:16239115-16239137 TGTCGAAGGAAGACAGGCAGAGG + Intronic
1093643936 12:21561175-21561197 TGTCAAAAGAAAGGAATGAGAGG + Intronic
1093719523 12:22422997-22423019 TGGAGAAGGGGAGGAGGGAGAGG + Intronic
1093720020 12:22429637-22429659 TGGAGAAGGGGAGGAGGGAGAGG + Intronic
1096693262 12:53333827-53333849 GGTCGAGGGACAGGAGGGACTGG + Intronic
1096764137 12:53869162-53869184 TGGAGAGGGGAAGGAGGGAGAGG - Intergenic
1098174564 12:67777581-67777603 TGTGGAAGGAAATGTGGGATTGG - Intergenic
1098862445 12:75725051-75725073 TGGAGGAGGAAGGGAGGGAGGGG + Intergenic
1099385296 12:82006223-82006245 AGAAGAAGGGAAGGAGGGAGGGG + Intergenic
1101711562 12:107271801-107271823 TGATGAAGGGAAGGAAGGAGAGG + Intergenic
1102764735 12:115422969-115422991 GGGAGAAAGAAAGGAGGGAGGGG + Intergenic
1103204774 12:119120098-119120120 TGGTGAAGGAAGGGAGGGAGGGG - Intronic
1103439274 12:120950711-120950733 TGTGGAGGGAGAGGCGGGAGCGG - Intergenic
1103936748 12:124481177-124481199 TGTAGAAGGAGAGAAGGAAGGGG + Intronic
1104374396 12:128251017-128251039 AGGGGAAGGGAAGGAGGGAGAGG + Intergenic
1104668752 12:130666638-130666660 TACCAAAGGAAGGGAGGGAGGGG + Intronic
1105562077 13:21501776-21501798 TGTGGCAGGAAAAGAAGGAGGGG - Intronic
1106508541 13:30392920-30392942 TGTGCAAGGAAAGGGAGGAGGGG - Intergenic
1107427926 13:40312925-40312947 TGTGGAAGGAAAGGAAGGGCAGG - Intergenic
1108162301 13:47653632-47653654 TGTGTGGGGAAAGGAGGGAGTGG + Intergenic
1108822883 13:54375217-54375239 TCTAGAAGGAGAGGAGAGAGTGG + Intergenic
1109159913 13:58958550-58958572 TGTGGAAGGAGAGGCGCGAGTGG - Intergenic
1109209007 13:59513293-59513315 CGTGGAGGTAAAGGAGGGAGAGG - Intergenic
1109242459 13:59906415-59906437 TGTGGAATGAAAAGAGGTAGTGG + Intronic
1109878896 13:68444931-68444953 TGTCAAGGGACTGGAGGGAGAGG - Intergenic
1110018028 13:70433554-70433576 CATAGAAGGAAAGGAGGAAGAGG + Intergenic
1110609852 13:77475822-77475844 TGTGGAGGGAAAGGTGGGGGCGG - Intergenic
1110792433 13:79600526-79600548 TGTGGAGGGAGAGGAGCGAGCGG - Intergenic
1111455794 13:88482192-88482214 TATCAGAGGAAAGGAGTGAGAGG + Intergenic
1111474550 13:88727297-88727319 GGAAGGAGGAAAGGAGGGAGAGG - Intergenic
1112131906 13:96533930-96533952 TGTGTAAGGAAAGGATGGATAGG - Intronic
1112317739 13:98379401-98379423 TGGAGAGGGAGAGGAGGGAGAGG + Intronic
1112738924 13:102452304-102452326 TGTAGAAGGAAATCAAGGAGAGG + Intergenic
1113911452 13:113843305-113843327 CGTTGAAGGACAGGAGGGAGCGG + Intronic
1117200701 14:53387066-53387088 GGTGGAAGGAAAGGAAGTAGTGG - Intergenic
1117959853 14:61152063-61152085 TGTGAAAGGACAGGAGGGAAGGG + Intergenic
1118808158 14:69255516-69255538 TGTTGATGGAAGGAAGGGAGAGG - Intergenic
1119110236 14:71965781-71965803 TGTGAAAGGTAAGGAGGGAAAGG + Intronic
1120191172 14:81441087-81441109 TGTTGGAGGGAAGGAGGGAAAGG - Intergenic
1120270005 14:82299721-82299743 TTTGGAAGGGAAGGAGAGAGAGG - Intergenic
1120330942 14:83092377-83092399 TGTGGAAGGAGAGGCGCGAGCGG + Intergenic
1120677901 14:87443359-87443381 AGTGGGAGGAAGGGAGGGAGGGG + Intergenic
1121098343 14:91233430-91233452 GGGGGAAGGAAAGGAGGAAGGGG - Exonic
1121661930 14:95641465-95641487 AGGCCAAGGAAAGGAGGGACAGG + Intergenic
1121844502 14:97160881-97160903 TGGGGAAGGAAAGGAGGTAGGGG - Intergenic
1121880501 14:97496468-97496490 GGAGGAAGGGAAGGAGGGAGGGG + Intergenic
1122164019 14:99807660-99807682 AGTGGAGGGGAAGGAGGGAGGGG - Intronic
1122275025 14:100586932-100586954 GGCGGAAGGAAAGGAGGGACGGG - Intronic
1122330354 14:100907987-100908009 AGTGCAAGGCAAGGAGGGAGGGG + Intergenic
1123724160 15:23085569-23085591 TGTGGAAGGAAAGGGGAGAATGG + Intergenic
1123905798 15:24920152-24920174 AGTGGAAGGTAAGGAGGAAGAGG - Intronic
1123984831 15:25636021-25636043 AGTCTAAGGAAAGGAGGGTCAGG - Intergenic
1124237232 15:28001442-28001464 GGTGGAAGGAGAGGAGGGTGTGG + Intronic
1124555740 15:30724127-30724149 GGAGAAAGGAAAGGAGGGAGGGG + Intronic
1124645638 15:31436130-31436152 TAAGGAAGGAAAGGAGGGCGGGG + Intergenic
1124675530 15:31681592-31681614 GGAGAAAGGAAAGGAGGGAGGGG - Intronic
1124864644 15:33477329-33477351 TATGGAAGCAAAGGAGTGAGAGG + Intronic
1125366403 15:38921156-38921178 TGACGAAGGAGAGGAGGTATGGG - Intergenic
1125508490 15:40280941-40280963 GGGAGAAGGAAAGGACGGAGGGG - Intronic
1126253232 15:46593484-46593506 TGGAGAATGGAAGGAGGGAGGGG - Intergenic
1126415931 15:48417437-48417459 GAAGGAAGGAAAGGAGGGAGGGG - Intronic
1126916672 15:53473848-53473870 TGAAGAAGTAAAGGAAGGAGCGG + Intergenic
1127354632 15:58186405-58186427 TGTCGAGGAAAGGTAGGGAGGGG + Intronic
1127409221 15:58688651-58688673 TGTCGAAAGAGGGGAGGGAAGGG + Intronic
1129461559 15:75702506-75702528 CGTGGGAGGAAAGGAGGGAGGGG + Intronic
1129666626 15:77582915-77582937 TCTGGAAGGACAGGAGGGAGAGG - Intergenic
1129698510 15:77754275-77754297 TGTGGAGGGAAGGGAGGGAGGGG + Intronic
1129723276 15:77889301-77889323 GGTGAAAAGAAAGGAGGGAGGGG - Intergenic
1130033950 15:80341238-80341260 TGTCCATGGAAAGGACGAAGTGG - Intergenic
1130794583 15:87195194-87195216 TGTCCCAGGAGATGAGGGAGTGG + Intergenic
1131488447 15:92841565-92841587 TATCAAAGGCAAGGAGGGTGAGG - Intergenic
1131649877 15:94387142-94387164 GGAGGAAGGAAAGGAGGAAGGGG - Intronic
1132027091 15:98412792-98412814 AGAGGAAGGAAGGGAGGGAGCGG + Intergenic
1133087445 16:3375902-3375924 GGAGGAAGGAAAGGAGGGAGGGG - Intronic
1133333144 16:4988599-4988621 GAAGGAAGGAAAGGAGGGAGGGG - Intronic
1133368757 16:5232072-5232094 TGACCAAAGAAAGGAGGAAGGGG - Intergenic
1133431676 16:5742361-5742383 TGGAGAAGGAGAGGAAGGAGAGG - Intergenic
1133551086 16:6855239-6855261 TGAGGAAGGGAGGGAGGGAGAGG + Intronic
1133589552 16:7229551-7229573 AGAGGAAGGAAGGGAGGGAGGGG + Intronic
1133589679 16:7230043-7230065 AGAGGAAGGAAAGGAGAGAGAGG + Intronic
1133589687 16:7230061-7230083 AGAGGAAGGAAGGGAGGGAGGGG + Intronic
1134040392 16:11063954-11063976 AGTTGAAGGGAAGGAGGGATTGG + Intronic
1134076409 16:11295009-11295031 TGTCCAGGGAGAGGAGGGATGGG - Intronic
1135110319 16:19685907-19685929 AGAGGAAGGAGAGGAGGGAGAGG - Intronic
1135186044 16:20316843-20316865 TGGAGGAGGAAAGGAGGGACAGG - Intronic
1135344312 16:21675481-21675503 AGTCCCAGGAAAGGAGGGGGTGG - Intergenic
1135976017 16:27109428-27109450 GGAGGAAGGAAAGGAAGGAGGGG + Intergenic
1136539966 16:30923703-30923725 GGTGGAAGGAAAGGATAGAGGGG - Intronic
1137399535 16:48142066-48142088 TGTGGGAGGAAAGGAGAAAGAGG + Intronic
1137626928 16:49914916-49914938 TGTCCCAGCAGAGGAGGGAGTGG + Intergenic
1138196827 16:55058205-55058227 TGTCTTGGCAAAGGAGGGAGTGG - Intergenic
1138656455 16:58494397-58494419 GGTGGAAGGAAGGGAGGGAAGGG - Intronic
1139782283 16:69361831-69361853 TGTCCAAGGAAGAGAGGGAGGGG - Intronic
1139787078 16:69402462-69402484 TGTGGGAGGAAGGGGGGGAGTGG - Intronic
1140009878 16:71120677-71120699 AAACGAAGGAAAGGAGGTAGAGG - Intronic
1140032806 16:71351830-71351852 TTTCTAAGGAAAGGAGGTGGAGG - Intergenic
1142135035 16:88448000-88448022 GAAGGAAGGAAAGGAGGGAGAGG + Intergenic
1142152008 16:88516796-88516818 TGTAGAAGGAGAAGGGGGAGGGG + Intronic
1143117353 17:4588512-4588534 TGCGGAAGGAAACCAGGGAGGGG - Intronic
1143513043 17:7406279-7406301 AGTGGGAGGGAAGGAGGGAGCGG + Intronic
1145883993 17:28370268-28370290 TGCCTGAGGAAGGGAGGGAGAGG + Exonic
1145920432 17:28605277-28605299 AGACCATGGAAAGGAGGGAGAGG + Intronic
1146403643 17:32519375-32519397 CGACAAAGGAAAGGCGGGAGGGG + Intronic
1146670795 17:34736307-34736329 TGGAGAAGGTGAGGAGGGAGAGG + Intergenic
1146670823 17:34736403-34736425 AGGAGAGGGAAAGGAGGGAGAGG + Intergenic
1146670828 17:34736418-34736440 GGGAGAGGGAAAGGAGGGAGAGG + Intergenic
1148463720 17:47851987-47852009 TCCCGAAGGACAGGAGGGCGAGG - Intronic
1148494619 17:48045843-48045865 TGTTGGGGGAAAGGAGGGGGTGG + Intergenic
1149422603 17:56525551-56525573 TGTGGAGGGAAAAGTGGGAGTGG - Intergenic
1149436871 17:56640524-56640546 TGAAAAAGGAAAGGAGAGAGGGG + Intergenic
1149548522 17:57522366-57522388 GGTCAAATGCAAGGAGGGAGGGG - Intronic
1150328770 17:64277807-64277829 GGTCTTAGGAAAGGAGGGAGGGG - Intergenic
1150555570 17:66251034-66251056 TGTGGAAGAAAAGGAGGGTCAGG - Intronic
1151229168 17:72670489-72670511 TGTAGAAGGAAGGGAGGAAATGG - Intronic
1151677175 17:75604543-75604565 TGTGGGAGGGAGGGAGGGAGGGG - Intergenic
1152357578 17:79814260-79814282 CGTCGAGGGAAAGGACCGAGAGG - Intergenic
1153664113 18:7352543-7352565 AGAGGAAGGAAAGAAGGGAGTGG - Intergenic
1155316468 18:24576867-24576889 TTTCGAGGGAAAGGAGAAAGTGG + Intergenic
1155789375 18:29946238-29946260 TGTCAAAGGGAAGGTAGGAGAGG + Intergenic
1157448327 18:47765212-47765234 GAAGGAAGGAAAGGAGGGAGAGG + Intergenic
1157605316 18:48922770-48922792 TGTGGAAGGAGGGGAGAGAGGGG - Intronic
1157653200 18:49358346-49358368 TGTAGAAGGAAAGAAGGCAAAGG + Intronic
1158127870 18:54121872-54121894 TGCTGAAGGCAAGGAGGTAGAGG + Intergenic
1158506012 18:58045865-58045887 TCTGAAAAGAAAGGAGGGAGGGG - Intronic
1158510278 18:58084449-58084471 TGTAGAAGGAAAGATGGGGGTGG + Intronic
1159891646 18:73958719-73958741 TGTCAAAGGACACAAGGGAGGGG + Intergenic
1160541040 18:79623152-79623174 GGTCGGACGTAAGGAGGGAGAGG + Intergenic
1160981665 19:1819131-1819153 TCTGGAAGGAAGGGAGGGAGGGG + Exonic
1161860143 19:6791912-6791934 TCTGGAAGGAAGGGAGTGAGTGG + Intronic
1162136979 19:8561429-8561451 GGAGGAAGGAAGGGAGGGAGAGG - Intronic
1162153425 19:8661047-8661069 GGGGGAAGGAAGGGAGGGAGGGG - Intergenic
1162153434 19:8661066-8661088 GGGGGAAGGAAGGGAGGGAGGGG - Intergenic
1162230102 19:9259507-9259529 TGTGGAGGGAAAGGCGCGAGCGG + Intergenic
1162233156 19:9283822-9283844 TGTGGAGGGAAAGGCGCGAGCGG - Intergenic
1162444406 19:10713291-10713313 GGAGGAAGGAAGGGAGGGAGGGG + Exonic
1163011646 19:14430379-14430401 AGAGGAAGGAAGGGAGGGAGGGG - Intergenic
1163142861 19:15362253-15362275 TGTAGAAGGAAAACAAGGAGGGG + Intronic
1164400142 19:27896481-27896503 GGTGGAAGGGTAGGAGGGAGAGG + Intergenic
1165105981 19:33469934-33469956 TGCAGAGGGAAAGCAGGGAGAGG - Intronic
1165279588 19:34784855-34784877 TGTTGAAAGAAAGGAAAGAGTGG - Intergenic
1165331396 19:35142809-35142831 GGAGGAAGGAAAGGCGGGAGAGG + Intronic
1165969175 19:39611253-39611275 ACTCGAAGGAAGGGTGGGAGGGG - Intergenic
1166206450 19:41272838-41272860 TCTGGAGGGAAAGGAGGGAAGGG - Intronic
1166246646 19:41532273-41532295 TGAGGAAGGACAGGAGGAAGGGG - Intergenic
1166252320 19:41579646-41579668 TATACAAGGAAAGGAGTGAGAGG - Intronic
1166327996 19:42062893-42062915 TGGGGAAGGAGAGGAGGCAGGGG - Intronic
1166648079 19:44547572-44547594 AGAGGAAGGAAGGGAGGGAGGGG + Intergenic
1167080241 19:47272966-47272988 TGGCGAAGGAAAGGGGAGGGCGG + Intergenic
1167091669 19:47348686-47348708 TGTAGAAAGAAAAGAGGTAGAGG + Intergenic
1167567562 19:50266553-50266575 TGTCGAAAGGAAGGAAGGAAGGG + Intronic
1167651131 19:50729648-50729670 TATGGAAGGAAGGGAGGGAGGGG + Intergenic
1167671690 19:50857253-50857275 TGGAGAAGGAATGGAGTGAGAGG - Intronic
1167944987 19:52981016-52981038 TGTCACAGGAAAGGAGTGAGTGG - Intergenic
1168053203 19:53845543-53845565 GAAGGAAGGAAAGGAGGGAGGGG - Intergenic
1168721864 19:58558679-58558701 TGGCGAGGGCAAGGAAGGAGCGG - Exonic
925087893 2:1125415-1125437 AGGCAAAGGAAGGGAGGGAGAGG - Intronic
925370750 2:3343696-3343718 TCTTGCAGAAAAGGAGGGAGAGG - Intronic
925445557 2:3923956-3923978 AGGGGAAGGAAAGGAGGGAAGGG - Intergenic
926778743 2:16447762-16447784 TGAAGAAGGAAGGAAGGGAGGGG + Intergenic
926921689 2:17946436-17946458 GGAGGAAGGAAGGGAGGGAGGGG - Intronic
927019253 2:19000116-19000138 TGTAGAAGGGCAGGAGGCAGAGG - Intergenic
927574445 2:24189821-24189843 TCTCAAAGGAAAGGCGGGAGGGG + Intronic
927874322 2:26644688-26644710 GGAAGAAGGAAAGCAGGGAGCGG + Intergenic
927886417 2:26721390-26721412 TGGGGGAGGAGAGGAGGGAGGGG - Intronic
928921750 2:36534370-36534392 AGGGGAAGGAAGGGAGGGAGGGG + Intronic
929456591 2:42070600-42070622 TCTTTAAGGAAAAGAGGGAGGGG - Intergenic
929800142 2:45092776-45092798 TGGGCAAGGAAAGGAAGGAGTGG - Intergenic
930511740 2:52354278-52354300 TGTGGAAGGAAATGATGAAGAGG - Intergenic
930702135 2:54469223-54469245 TGCTGAAGGAAAAGAGGGAGTGG + Intronic
931202331 2:60110295-60110317 TGTCGAGGGAAAAGAGCCAGAGG + Intergenic
931241097 2:60453295-60453317 TGGTGAAGGGAAGAAGGGAGTGG + Intronic
931790881 2:65663100-65663122 GCTGGAAGGAAAGGAGGGTGGGG + Intergenic
932314234 2:70768793-70768815 TGAGGAAGGAAAGGAGTGAGAGG - Intergenic
932369349 2:71174576-71174598 TGCAGAGGGGAAGGAGGGAGGGG + Intergenic
933723639 2:85413875-85413897 TGTGGGAGAAGAGGAGGGAGCGG + Intronic
933805770 2:85997280-85997302 GGTAGAAGGAAGGGAGGGACTGG - Intergenic
934863884 2:97788630-97788652 CCTCGAAGAAAAAGAGGGAGGGG - Intronic
935131304 2:100263130-100263152 GAAGGAAGGAAAGGAGGGAGGGG - Intergenic
935233567 2:101119471-101119493 TCTAGAAGGAAAGGAGTCAGAGG - Intronic
936055208 2:109257381-109257403 AGAGGAAGGGAAGGAGGGAGAGG + Intronic
936068331 2:109348749-109348771 TGAAGATGGAAAGGAGGAAGGGG - Intronic
937724293 2:125143143-125143165 TGGAGGAGGAAAGGAGGGAGAGG + Intergenic
938308229 2:130268677-130268699 TGTGGAGGGAAAGGCTGGAGGGG + Intergenic
938447100 2:131388159-131388181 TGTGGAGGGAAAGGCTGGAGGGG - Intergenic
938891447 2:135709697-135709719 AGTAGAAGGAAAGGAAGAAGTGG - Intronic
939008700 2:136819758-136819780 TGAAGAAAGAAGGGAGGGAGAGG - Intronic
939280074 2:140052555-140052577 GGAGGAAGGAAAGGAGGAAGAGG + Intergenic
939379819 2:141420685-141420707 TTTAGAAGGAAAGGAGGGAGTGG - Intronic
939511272 2:143108936-143108958 TGACGAAGGACAGGATGGAAAGG - Intronic
939995887 2:148919207-148919229 TGTAGACAGAAAGGAGGCAGAGG + Intronic
940366836 2:152857725-152857747 TGTGGAGGGAAAGGAGGGTGAGG + Intergenic
940711437 2:157167144-157167166 TGTCCAAGGGCAGGAGGGATGGG - Intergenic
940937490 2:159513869-159513891 TGTCAAAGGAAATGAGTGAGTGG - Intronic
940987242 2:160062217-160062239 GGTCGAAGGAGAGGAAGAAGGGG - Intronic
941296577 2:163746268-163746290 TCTAGAAGGAAAGGACGAAGAGG + Intergenic
942266632 2:174234045-174234067 AGTGGAAGGAGAGGAAGGAGGGG - Intronic
942447790 2:176089705-176089727 TCTGGAAGAAAAGGAGGAAGAGG + Intergenic
942916564 2:181315967-181315989 TTTGGAAGGAAAGAAGGGAAAGG + Intergenic
944055157 2:195515672-195515694 TGTGGAAGGAGAGGCGGGGGCGG + Intergenic
944523258 2:200592767-200592789 TAAGAAAGGAAAGGAGGGAGGGG - Intronic
945614630 2:212052783-212052805 TGTTGAAAGAAATTAGGGAGGGG - Intronic
945693972 2:213079456-213079478 GAAGGAAGGAAAGGAGGGAGGGG + Intronic
946035262 2:216736864-216736886 GGAGGAAGGAAAGGAGGGAAGGG - Intergenic
946133927 2:217629855-217629877 TGAAGCAGGAAAGGAGGGAAAGG - Intronic
946252469 2:218421950-218421972 TGTCAAAGAAAAAGAGGGACGGG + Intronic
946458329 2:219847861-219847883 TGTAGAAGAAAAGGTGGAAGAGG - Intergenic
946551314 2:220804629-220804651 CGTCCAAGGCAAGGAAGGAGAGG - Intergenic
946770892 2:223087140-223087162 AGTAGAAAGAAAGGAGGCAGTGG - Intronic
948663625 2:239521399-239521421 TGTCGCAGGAAGAGAGGGAATGG - Intergenic
1169166971 20:3432411-3432433 TGGAGAAGAAAATGAGGGAGAGG - Intergenic
1169590686 20:7138194-7138216 TGTCTAAGAACAGGAGGGAGAGG - Intergenic
1169951031 20:11043372-11043394 TGTAGAAGAAAAGGAGGGTGTGG + Intergenic
1170032720 20:11959406-11959428 GGAGGAAGGAGAGGAGGGAGAGG + Intergenic
1170624625 20:18021787-18021809 GGTGGAAGGAAAGGAGGGAGGGG + Intronic
1170662100 20:18352139-18352161 TCTGGAAGGAAAGGATGGAGGGG - Intergenic
1170858456 20:20079486-20079508 TGTTGAAGGGAAGCAGAGAGAGG + Intronic
1170915008 20:20614100-20614122 TGAAGAAGGAAAGGAGGGATGGG + Intronic
1172133999 20:32675132-32675154 TGCAGCAGGACAGGAGGGAGGGG - Intergenic
1172943529 20:38671083-38671105 TGTTGCAGGAAGGGAGGGAAAGG + Intergenic
1173413128 20:42832364-42832386 TGGAGAGGGAGAGGAGGGAGGGG + Intronic
1173490359 20:43474708-43474730 AGGCCAAGGACAGGAGGGAGTGG + Intergenic
1173513705 20:43650035-43650057 GGTGGGAGGAAAGGGGGGAGGGG + Intergenic
1173752799 20:45489968-45489990 TGTAGAAGGACAGGAGAAAGTGG - Intergenic
1173759946 20:45550573-45550595 AGTGGAAGGAAAGGAGGGATAGG + Intergenic
1173860138 20:46277866-46277888 CTTTGAAGGGAAGGAGGGAGGGG + Intronic
1173878466 20:46392293-46392315 TGTGGAAGGAAAGGGGAGAATGG - Intronic
1175388867 20:58614003-58614025 TGTGGAAGGACAGGAGGCAGTGG - Intergenic
1175801167 20:61801751-61801773 TGTGGAAAGAAAGCAGAGAGAGG - Intronic
1175984017 20:62755306-62755328 GGAGGAAGGAAGGGAGGGAGAGG - Intronic
1176927202 21:14764715-14764737 GGTGGAAGGCAAAGAGGGAGTGG - Intergenic
1177565870 21:22819207-22819229 TGTGGAAGGAGAGGCGTGAGTGG - Intergenic
1177685614 21:24434072-24434094 TGTTGAAGGAAATGAGGAAAGGG - Intergenic
1178771345 21:35507335-35507357 TGGGGAATGCAAGGAGGGAGAGG - Intronic
1179061455 21:37983154-37983176 GAAGGAAGGAAAGGAGGGAGGGG - Intronic
1179581226 21:42345588-42345610 TTTCTAAGGCAAGCAGGGAGGGG - Intergenic
1180081512 21:45489809-45489831 AGTCGGGGAAAAGGAGGGAGAGG - Intronic
1181063716 22:20295189-20295211 GGTGGAAAGAAGGGAGGGAGAGG - Intergenic
1181298642 22:21863060-21863082 TGTAGACGGGGAGGAGGGAGAGG - Intronic
1182033201 22:27176248-27176270 GGGAGAAGGAAAGAAGGGAGAGG + Intergenic
1182077941 22:27507479-27507501 CTAGGAAGGAAAGGAGGGAGGGG + Intergenic
1183062973 22:35346900-35346922 GGTAGAAGGAAAGGAGGCAGAGG - Intronic
1183162801 22:36126374-36126396 GGAGGAAGGAAAGGAGGGAGAGG - Intergenic
1183162808 22:36126396-36126418 GAAGGAAGGAAAGGAGGGAGAGG - Intergenic
1183162885 22:36126704-36126726 GAAGGAAGGAAAGGAGGGAGAGG - Intergenic
1183162891 22:36126726-36126748 GAAGGAAGGAAAGGAGGGAGAGG - Intergenic
1183162897 22:36126748-36126770 GAAGGAAGGAAAGGAGGGAGAGG - Intergenic
1183274586 22:36885657-36885679 TGGGGAAGGAGAGGAGGGCGGGG - Intergenic
1183324439 22:37183811-37183833 AGCCCAAGGAAAGGAAGGAGTGG + Intronic
1183560737 22:38570450-38570472 TGACGGAGGGAGGGAGGGAGGGG + Intergenic
1184468031 22:44680383-44680405 AGTGGAAGGAAAGGGGGGATGGG + Intronic
1184581383 22:45420168-45420190 TGTGGAAAGAATGGAGTGAGAGG - Intronic
1184770516 22:46594330-46594352 TGTGGAAGGACAGGTGGAAGTGG + Intronic
1185201210 22:49506625-49506647 TTTTGAAGGAAGGAAGGGAGGGG + Intronic
1185377491 22:50488948-50488970 TGCAGAAGGACAGGAGGGACGGG - Intronic
950358681 3:12434463-12434485 GGAAGAAGGAAAGGAGGGAAGGG - Intergenic
950583984 3:13880116-13880138 GGACGGGGGAAAGGAGGGAGGGG - Exonic
950718936 3:14868758-14868780 TGTGGAAGAAGAGGAGGGACTGG - Intronic
952017741 3:28978507-28978529 AGTGGAAGAAAAGGAAGGAGCGG + Intergenic
952598100 3:35043799-35043821 AGAGGAAGAAAAGGAGGGAGAGG + Intergenic
953443738 3:42944146-42944168 TATCCAAGGAATGGAGGGTGGGG - Intronic
953664892 3:44918419-44918441 TGTGGAAGGAAAGAAGGGGAGGG - Intronic
953793307 3:45964860-45964882 TGTCCAGGGAATGGATGGAGGGG + Intronic
954013349 3:47663138-47663160 GGAGGAAGGAAAGGAGGGAAGGG + Intronic
955015543 3:55065661-55065683 TGTCGAAAGAAAGAAGAGAGAGG + Intronic
955611847 3:60765895-60765917 TGTCCAAGGGCAGGAGGGATGGG - Intronic
955769498 3:62373623-62373645 GGTGGAAGGAAAGGGGGGGGGGG + Intronic
956161784 3:66362513-66362535 TGAGGAAGGACAGGAAGGAGGGG + Intronic
956463452 3:69494960-69494982 AGGGGAAGGAAAGGAAGGAGAGG + Intronic
957099423 3:75809335-75809357 TGAAGCAGCAAAGGAGGGAGAGG - Intergenic
957373637 3:79328771-79328793 TGACGGGGGAAAGGTGGGAGAGG - Intronic
957419712 3:79951738-79951760 TGTGGAGGGAGAGGCGGGAGCGG - Intergenic
958419842 3:93917608-93917630 TGTGGAGGGAAAGGCGCGAGGGG + Intronic
958473916 3:94556245-94556267 TGTAGGAGGGAAGGAGGAAGGGG + Intergenic
958571731 3:95893036-95893058 TCTTGAAGGACAAGAGGGAGTGG - Intergenic
958728112 3:97930988-97931010 TGTTCCAGGGAAGGAGGGAGAGG - Intronic
958737517 3:98026343-98026365 GGACGAAGGAAAGCAGGCAGTGG + Intronic
959463431 3:106654659-106654681 TGAAGATGGGAAGGAGGGAGAGG + Intergenic
960316610 3:116186269-116186291 TGATGGAGGAAAAGAGGGAGGGG - Intronic
960388470 3:117050017-117050039 AGACGAGGGAGAGGAGGGAGAGG - Intronic
961034023 3:123629775-123629797 TGTGGAAAGAAAAGAGGGTGTGG + Intronic
961415054 3:126750995-126751017 TCTGGAAGGGTAGGAGGGAGAGG + Intronic
961416565 3:126763247-126763269 AGGGGAAGGAAAGGAAGGAGAGG - Intronic
961514399 3:127423689-127423711 AGTAGAAAGGAAGGAGGGAGTGG - Intergenic
962625873 3:137225346-137225368 AGGGGAAGGAAAGGAGGGAATGG - Intergenic
963350196 3:144142050-144142072 AGAGGAAGGAAAGGAGGGAGAGG - Intergenic
963351632 3:144158986-144159008 AGAAGGAGGAAAGGAGGGAGGGG + Intergenic
963498209 3:146095896-146095918 TGTGGAGGGAGAGGGGGGAGGGG - Intronic
964182331 3:153903671-153903693 TGTAGCAGCACAGGAGGGAGGGG + Intergenic
964633206 3:158834704-158834726 TGAAGATGGAAAGGAGGGACAGG + Intergenic
965220932 3:165924673-165924695 TGTGGAAGGAGAGGCGCGAGTGG - Intergenic
965298086 3:166975827-166975849 TGTGGAAGGAGAGGCGCGAGCGG + Intergenic
965347833 3:167574109-167574131 TGTGGAATGAAAGAAGGGAAGGG - Intronic
966912335 3:184566438-184566460 TGTGGCAGGAAAGGAGGAGGTGG + Intronic
966988205 3:185201562-185201584 TGTCAGAGGACACGAGGGAGCGG + Intronic
967008071 3:185403922-185403944 AGTAAAAGGAAAGGAAGGAGGGG - Intronic
967118795 3:186364520-186364542 TGTGGAAGGCAAAGAGGGATGGG + Intergenic
967199553 3:187060044-187060066 TGTGGAAGGAAATGGGGGACTGG + Intronic
967448463 3:189596117-189596139 TGTGGAAAGAGAGGTGGGAGCGG + Intergenic
968234612 3:197024245-197024267 GGGCCAAGGAAAGGAGGGGGAGG + Intronic
968288168 3:197520156-197520178 TGTGGAGGGGAAGCAGGGAGAGG + Intronic
968937228 4:3617584-3617606 GTGGGAAGGAAAGGAGGGAGGGG - Intergenic
968953676 4:3707533-3707555 CGGAGAAGGAAGGGAGGGAGTGG - Intergenic
969322000 4:6417996-6418018 TCTGGAAGGGAAGGAGGGGGTGG + Intronic
969467449 4:7366171-7366193 TCTCGAAGGTGAGGAAGGAGAGG + Intronic
969479128 4:7437843-7437865 GGTGAGAGGAAAGGAGGGAGGGG - Intronic
969479244 4:7438791-7438813 GGTGAGAGGAAAGGAGGGAGGGG - Intronic
969505560 4:7585077-7585099 TGTTGATGGACAGGAGGAAGAGG + Intronic
970428289 4:15965169-15965191 TGTCAAGGGCAAGGAGGCAGTGG + Intronic
970587195 4:17526064-17526086 AGAAAAAGGAAAGGAGGGAGGGG - Intronic
970757318 4:19442678-19442700 TGTCTAAGTCAAGGAAGGAGAGG + Intergenic
970833540 4:20371528-20371550 TGTTGAAGAAAAGATGGGAGTGG - Intronic
971383296 4:26119579-26119601 TGTGGATAGAAAGGAAGGAGGGG - Intergenic
971639784 4:29117346-29117368 TGTGGAGGGAGAGGCGGGAGCGG + Intergenic
973875946 4:55218620-55218642 TGTTGAGGGGAAGGAGGAAGAGG - Intergenic
974641783 4:64640840-64640862 TGTGGAGGGAAAGGCGCGAGCGG - Intergenic
974869168 4:67617745-67617767 AGTAGAAGGAAAGGAGCTAGAGG + Exonic
976028997 4:80728596-80728618 TGTGGAAGGAAAGATGGGTGAGG - Intronic
976832949 4:89335697-89335719 GGTGGAGGGAAGGGAGGGAGTGG - Intergenic
977483432 4:97609454-97609476 TGTCATAAGAAAGGAGGAAGAGG + Intronic
978277347 4:106967881-106967903 AGAAGAAGGAAGGGAGGGAGAGG + Intronic
978428230 4:108604478-108604500 TACAGAAAGAAAGGAGGGAGGGG + Intergenic
982397564 4:154928507-154928529 TGGAGAAGGAAATGAGGGAAGGG + Intergenic
982921226 4:161277236-161277258 TGTGGAAGGAGAGGCGCGAGCGG + Intergenic
983093126 4:163529510-163529532 TGTAAAAGGAAAGGAAGGAATGG + Intronic
985022468 4:185706523-185706545 GAAGGAAGGAAAGGAGGGAGGGG - Intronic
985056077 4:186036617-186036639 GGTGGAAGAAAAAGAGGGAGCGG - Intergenic
985086486 4:186318206-186318228 GGTGGAAGGAAAGGATGGATGGG + Intergenic
985203212 4:187505624-187505646 TGTGGAGGGAGAGGCGGGAGCGG + Intergenic
985403911 4:189617012-189617034 TGTGGAGGGAGAGGCGGGAGCGG - Intergenic
985648542 5:1096712-1096734 GGAGGAAGGAAAGGAGGGAGGGG + Intronic
985648560 5:1096756-1096778 GGAGGAAGGAAAGGAGGGAGGGG + Intronic
986210188 5:5664761-5664783 TGGCCAAGGAGAAGAGGGAGGGG + Intergenic
988220755 5:28344040-28344062 CGTAGAAGGAAAGGCAGGAGAGG - Intergenic
988461969 5:31447238-31447260 TGGAGAACAAAAGGAGGGAGAGG + Intronic
988684778 5:33515753-33515775 TGTGGAGGGAAAGGCGCGAGCGG - Intergenic
988711666 5:33784311-33784333 TGTTGAATGAAAGTAGTGAGAGG - Intronic
992540595 5:77760426-77760448 TGTCGAAAGAAAGAAAGGAGAGG - Intronic
992559734 5:77939304-77939326 TGGGGAAGAGAAGGAGGGAGAGG - Intergenic
992865876 5:80956812-80956834 GGAGGAAGGAAAGGTGGGAGGGG - Intergenic
993350576 5:86844950-86844972 TGTGTAAGGGAAGGTGGGAGAGG + Intergenic
993710236 5:91217069-91217091 GGTGGAAGGAAAGGTGGAAGGGG + Intergenic
995142053 5:108745866-108745888 AGATGAAGAAAAGGAGGGAGGGG + Intergenic
995568637 5:113457138-113457160 TGTGGAGGGAGAGGCGGGAGCGG + Intronic
995658042 5:114449218-114449240 TGGAGAAGGAGAGGAGGGAGAGG - Intronic
996087762 5:119321928-119321950 TGAGGCAGGGAAGGAGGGAGTGG - Intronic
996502791 5:124235503-124235525 GGAGGAAGGAAAGGAGAGAGAGG + Intergenic
996693529 5:126367472-126367494 AGTAGAGGAAAAGGAGGGAGAGG + Intronic
996798426 5:127376314-127376336 TGGTGAAAGAAAAGAGGGAGAGG + Intronic
998485390 5:142497739-142497761 TGTCGAAAGAGGGGAGGGGGAGG - Intergenic
998525983 5:142843754-142843776 AGTGGAAGGAAAGAAGGTAGAGG - Intronic
998729332 5:145056243-145056265 TAGCGAAGCAGAGGAGGGAGGGG - Intergenic
999227925 5:150042600-150042622 TGTGGGAGGGAGGGAGGGAGTGG + Intronic
999229414 5:150052837-150052859 TGGCCAGGGAAAGGAGGAAGGGG - Intronic
1000006280 5:157187756-157187778 TGTAAAAGGCAAGGAAGGAGGGG - Intronic
1000070106 5:157732442-157732464 TGTCTCAGAAAAAGAGGGAGGGG + Intronic
1000220284 5:159208684-159208706 AGACGAAGGGAAAGAGGGAGGGG + Intronic
1000763386 5:165254597-165254619 GGAAAAAGGAAAGGAGGGAGAGG - Intergenic
1001204663 5:169751155-169751177 TGATGAAGTAAAGGAGGAAGAGG - Intronic
1001313041 5:170624803-170624825 TGAGGAAGGAAAGGAGAGTGAGG - Intronic
1001477921 5:172064247-172064269 TGACGAAGGACTGGAGGGAAAGG + Intronic
1001564097 5:172688422-172688444 TGAAGGAGGGAAGGAGGGAGAGG + Exonic
1001685743 5:173593625-173593647 TGTGGAAGGGAAGGAGAGTGAGG - Intergenic
1003139465 6:3457919-3457941 TGGAGCAGGAGAGGAGGGAGAGG - Intergenic
1003399884 6:5782682-5782704 TGGGGGAGGAAAGGAGTGAGAGG - Intergenic
1003851392 6:10226341-10226363 GAAGGAAGGAAAGGAGGGAGGGG + Intergenic
1004089750 6:12488834-12488856 TGAGGAAGGAAAGGGAGGAGAGG + Intergenic
1004131224 6:12921714-12921736 TGAAGAAGGGAAGGAAGGAGAGG + Intronic
1004235579 6:13872288-13872310 TGTGGAGGGAGAGGAGCGAGCGG - Intergenic
1004299424 6:14443820-14443842 TGTTGACAGGAAGGAGGGAGGGG + Intergenic
1004898108 6:20168746-20168768 GGAGGAAGGAAGGGAGGGAGGGG + Intronic
1005140467 6:22626186-22626208 TGGCACAGGAAAGGAGGGTGGGG - Intergenic
1005994532 6:30923293-30923315 TCTGGAAGGAAAGGAGGCAGGGG + Intronic
1006293744 6:33160567-33160589 TGGCGAAGGAGAGGAGGGTTTGG - Intergenic
1006695972 6:35931261-35931283 TGTGGAGGGAGAGGAGCGAGGGG + Intergenic
1007784572 6:44272325-44272347 TGTCCTAGGATGGGAGGGAGGGG - Intronic
1007850466 6:44798001-44798023 TGTAGGATGAAAGGAGGCAGTGG + Intergenic
1008701513 6:54106101-54106123 TGTAGATGGGAAGGAGGCAGAGG + Intronic
1008863182 6:56176616-56176638 AGAGGAAGGAAAAGAGGGAGGGG + Intronic
1010810982 6:80298725-80298747 TGGAAAAGGAAAGGAGAGAGAGG + Intronic
1010828242 6:80498740-80498762 TGCAGAAGGAGAGGAGGAAGGGG + Intergenic
1011601574 6:89065018-89065040 TGTGGAAGGAGAGGCGTGAGCGG + Intergenic
1011927086 6:92659350-92659372 TCTGGAAGAAAAGGAGTGAGGGG - Intergenic
1012974309 6:105763582-105763604 AGTCAGAGGAAAGGAGGAAGAGG - Intergenic
1013040002 6:106424003-106424025 GAGAGAAGGAAAGGAGGGAGAGG - Intergenic
1013082735 6:106826763-106826785 AGAGGAAGGAAGGGAGGGAGGGG + Intergenic
1013929022 6:115507618-115507640 TGTTAAAGGAAATGATGGAGGGG - Intergenic
1015700714 6:136033384-136033406 TGAATAAGTAAAGGAGGGAGAGG + Intronic
1015868848 6:137755314-137755336 GAAAGAAGGAAAGGAGGGAGAGG + Intergenic
1016037068 6:139394300-139394322 TTTCCATGGAGAGGAGGGAGAGG + Intergenic
1016067412 6:139698281-139698303 TGTGGAAGGAGAGGCGCGAGCGG - Intergenic
1016217153 6:141618206-141618228 TGTGGAGGGAAAGGCGCGAGCGG + Intergenic
1017800576 6:157892123-157892145 GGTGGAAGGAAAGGACAGAGAGG + Intronic
1017999468 6:159566117-159566139 GCTGGAAGGAAAGTAGGGAGAGG + Intergenic
1018039658 6:159910731-159910753 TTTGGAAGGAAGGGAGGGAGGGG - Exonic
1018644692 6:165936650-165936672 TGTGAAACGAAAGGAGAGAGAGG + Intronic
1018852749 6:167653008-167653030 TGTTGCAGGAAGGGACGGAGAGG + Intergenic
1019147056 6:169982257-169982279 ACGGGAAGGAAAGGAGGGAGGGG + Intergenic
1019265643 7:116176-116198 TGTGGAGGGCAAGGAGGGCGAGG - Intergenic
1019994956 7:4718013-4718035 TGTTGAAGGAAAGGAAAGTGGGG + Intronic
1020927381 7:14348165-14348187 TGTCGAAGGAAAGGAGGGAGTGG - Intronic
1021174681 7:17437558-17437580 TGACCAAGGAAAGGAGGGTTGGG + Intergenic
1022951517 7:35343039-35343061 TGTCCAAGGACAGGAGGAATGGG + Intergenic
1023950691 7:44841844-44841866 TGTAGAAGGAAAGGAACCAGCGG - Intronic
1024199668 7:47093057-47093079 GGTAGGAGGAAAGGAGGGATAGG + Intergenic
1024318983 7:48046392-48046414 GATGGAAGGAAGGGAGGGAGTGG + Intronic
1024472742 7:49780156-49780178 TGACGAAGGCACGGAGTGAGTGG + Intronic
1024604403 7:51012463-51012485 AGAGGAAGCAAAGGAGGGAGAGG + Intergenic
1024890008 7:54189216-54189238 TGTAGCAAGAAAGGAGGGTGAGG + Intergenic
1024918072 7:54525732-54525754 GGTCGAGGGAAAGGAGGGCTTGG + Intergenic
1026027650 7:66760178-66760200 TGTCGAAGGCAAGGAAGAGGAGG - Intronic
1026638862 7:72106821-72106843 GGAGGAAGGAAGGGAGGGAGGGG + Intronic
1026971647 7:74472256-74472278 TGTCCAAGGAAGGGAAAGAGGGG - Intronic
1027564081 7:79768330-79768352 TGTGGAGGGAGAGGCGGGAGCGG - Intergenic
1027597765 7:80197085-80197107 TGGGGGAGGAGAGGAGGGAGAGG - Intronic
1028027446 7:85863974-85863996 GGTAGAAGGAAATGAGGGACAGG + Intergenic
1028852562 7:95552832-95552854 TGTGGAGGGAGAGGCGGGAGCGG - Intergenic
1029247695 7:99214624-99214646 TTTCAAAGGAAAGAGGGGAGGGG + Intergenic
1029795867 7:102893890-102893912 AGAGGAAGGAAGGGAGGGAGGGG + Intronic
1030055787 7:105582868-105582890 TGTTGAAGGAGAAGAGGGTGCGG - Intronic
1030155206 7:106447977-106447999 TATGGAAGGAAAGGAGGGACTGG - Intergenic
1030282329 7:107789858-107789880 GGTGGAAGGGAAGGAGAGAGAGG - Intronic
1030303269 7:107995309-107995331 TCTCAAAGGAAAAAAGGGAGGGG + Intronic
1031292299 7:119951877-119951899 TGTGGAAGGAGAGGCGCGAGCGG - Intergenic
1031556821 7:123187518-123187540 AGGAGAAGGAAATGAGGGAGTGG - Intronic
1031706569 7:124987726-124987748 AGTTGAAGGAAATGAAGGAGTGG + Intergenic
1031738797 7:125401008-125401030 TATCTAAGCAAAGGAAGGAGAGG - Intergenic
1031853746 7:126897574-126897596 GGAGGAAGGAAGGGAGGGAGAGG + Intronic
1031858609 7:126952364-126952386 TGTTGAAAGAAAGAAGGAAGTGG + Intronic
1031984970 7:128158259-128158281 GGTGGAGGGAATGGAGGGAGGGG - Intergenic
1033975051 7:147091156-147091178 TGTTTAAGGAAAGAAGGAAGGGG - Intronic
1034065878 7:148136084-148136106 GGTGGAAGGAATGGAGGGAACGG + Intronic
1034263758 7:149772139-149772161 TGGGGGAGGAGAGGAGGGAGGGG - Intronic
1034543036 7:151771416-151771438 TGCAGGAGGAAAGGAGGAAGTGG - Intronic
1035383957 7:158458182-158458204 TGGGGCAGGAAAGGAGGAAGCGG - Intronic
1035738032 8:1903181-1903203 TGACAATGGAAAGGAGGCAGTGG - Intronic
1036616933 8:10395386-10395408 TGTAGAAAGAGAGTAGGGAGTGG + Intronic
1036984740 8:13515959-13515981 TGTGGAAGGAAAGAAGAGGGAGG + Intergenic
1037303685 8:17481997-17482019 TGTACATGGAAAGGAGGGTGTGG - Intergenic
1037424919 8:18745296-18745318 TGTGAAAGGAAAGGAGGAAATGG - Intronic
1037480654 8:19302220-19302242 TGAGGAAGGAAAGAAGGAAGGGG + Intergenic
1037485601 8:19343882-19343904 TGTGGAAGGCAGGGATGGAGTGG + Intronic
1037773746 8:21818994-21819016 TCTCGAAAGAAAAGAGAGAGAGG - Intergenic
1038449993 8:27633820-27633842 CGAGGGAGGAAAGGAGGGAGAGG + Intergenic
1038847636 8:31244472-31244494 TGTGGAGGGAGAGGCGGGAGCGG - Intergenic
1038870659 8:31489850-31489872 TGTGGAAGGAGAGGTGCGAGCGG + Intergenic
1038923317 8:32110330-32110352 AGTCAAAGGAAAGGAGAGAAGGG + Intronic
1039254970 8:35709126-35709148 TGCTGAAGGAAAGAAGGGATGGG - Intronic
1039462174 8:37754263-37754285 TTTCTAGGGAAAGGAGGGTGGGG + Exonic
1040812832 8:51475771-51475793 TGGTGAGGGAAGGGAGGGAGGGG - Intronic
1040856999 8:51958706-51958728 AGCAGAATGAAAGGAGGGAGAGG - Intergenic
1040986427 8:53298818-53298840 GGTCGAGGGGCAGGAGGGAGAGG - Intergenic
1041341103 8:56846682-56846704 TGTAGAAAGAAAGGAAGGATAGG + Intergenic
1041525022 8:58795755-58795777 GGAGGAAGGAAGGGAGGGAGAGG - Intergenic
1041525128 8:58796800-58796822 TGTGGGATGAAAGGAGGGAAGGG + Intergenic
1041618302 8:59934244-59934266 TGTGGAGAGAAAGAAGGGAGGGG + Intergenic
1041886208 8:62811039-62811061 TTGGGAAGGAAAGGAGGAAGGGG - Intronic
1043910502 8:85858329-85858351 TGAACAAGGAAAGGAGGGAAAGG + Intergenic
1044307673 8:90656809-90656831 GGTGGAAGGAAAGTATGGAGTGG + Intronic
1045944197 8:107776833-107776855 TAGAGCAGGAAAGGAGGGAGGGG - Intergenic
1046146119 8:110160807-110160829 AGAGGAAGGAGAGGAGGGAGAGG + Intergenic
1046239517 8:111472333-111472355 TGGAGAGGGAGAGGAGGGAGAGG + Intergenic
1046871382 8:119208695-119208717 CGTCGAAGGGAAGGAGGCCGGGG - Intronic
1047958995 8:129997136-129997158 GGAGGGAGGAAAGGAGGGAGAGG + Intronic
1048053981 8:130846580-130846602 GGAGGAAGGAAGGGAGGGAGGGG - Intronic
1050275934 9:4000381-4000403 CTTCTAAGGAGAGGAGGGAGAGG + Intronic
1050288943 9:4133471-4133493 GGTGGAAGGAAAGAAGTGAGAGG + Intronic
1050366363 9:4877219-4877241 TCTCGAGGGAGGGGAGGGAGGGG + Intronic
1050587345 9:7126194-7126216 TGTGGAAGGAGAAGAGGGGGAGG + Intergenic
1050767058 9:9147760-9147782 TGTAGAAGGGAAGCAGGGAGAGG - Intronic
1051323969 9:15944405-15944427 TGTAAAAGGAAAGGATGGGGAGG + Intronic
1051720020 9:20027648-20027670 TTTTGAAGGGAAGGAGGGATGGG + Intergenic
1051765647 9:20520203-20520225 TGGAGAGTGAAAGGAGGGAGAGG + Intronic
1051782353 9:20703308-20703330 TGTCGAAGGAGCTGAGGGTGTGG + Intronic
1052399909 9:27987320-27987342 TGTCTCAGGAAAGGAGGGAAGGG - Intronic
1053018161 9:34675843-34675865 TGTCAGAGGGAAGTAGGGAGGGG + Intergenic
1053053208 9:34978149-34978171 GGAGAAAGGAAAGGAGGGAGAGG - Exonic
1053367400 9:37532935-37532957 AGTGGAAGGGAAGGTGGGAGAGG - Intronic
1053447891 9:38166990-38167012 TGAAGAAGGGAAGGAGGAAGGGG - Intergenic
1054453917 9:65420088-65420110 GTGGGAAGGAAAGGAGGGAGGGG + Intergenic
1054722403 9:68617017-68617039 TGTGGAGGGAAAGGCGCGAGTGG + Intergenic
1054766947 9:69050032-69050054 ACTAGAAGGAAAAGAGGGAGGGG - Intronic
1055006583 9:71514420-71514442 TGTAGATTGAAAGGAGGGAGCGG - Intergenic
1055022049 9:71680494-71680516 TGTTGAAGGGAAAGAGGGAAAGG + Intergenic
1056203988 9:84302870-84302892 TCTCTAAGGAAAAGAGGTAGGGG + Intronic
1056329146 9:85507578-85507600 TGGAAAAGGAAAGGAGGCAGGGG + Intergenic
1056331795 9:85527210-85527232 AGTCAAAGGAAAGGAGAGAAGGG + Intergenic
1056536530 9:87532742-87532764 TGTTGGAAGAAAAGAGGGAGAGG - Intronic
1057169070 9:92950015-92950037 AGAGGAAGGAAAGAAGGGAGGGG - Intronic
1057195843 9:93115406-93115428 TGAGGAAGGAGATGAGGGAGGGG + Intergenic
1057519721 9:95751576-95751598 TGTGGAAGGGAGGGAGGGAGGGG + Intergenic
1057519756 9:95751699-95751721 TGCGGAAGGGAAGGAAGGAGGGG + Intergenic
1057554837 9:96079724-96079746 TGTAGAAGGAAAGCAGGAAGAGG + Intergenic
1057713608 9:97469416-97469438 TGGCCAAGGAAAGGAGTTAGTGG + Intronic
1059183174 9:112239728-112239750 TGTTGAAAGAAAGAAGAGAGAGG + Intronic
1059935421 9:119305656-119305678 TGGGGAAGGAGAGGAGGAAGAGG - Intronic
1059987540 9:119835266-119835288 GGAGGGAGGAAAGGAGGGAGGGG + Intergenic
1060735731 9:126065547-126065569 GGAGGAGGGAAAGGAGGGAGGGG - Intergenic
1060747051 9:126144382-126144404 TGTCCAGGGAAAGGAGAGAGAGG - Intergenic
1060816050 9:126635837-126635859 TCTCAAAGGAAAGGAGGGGAGGG + Intronic
1061056375 9:128224950-128224972 TGTGGATGGAAGGGAGGGAGAGG - Intronic
1061147977 9:128811051-128811073 TGTTGAATGAAAGTAGAGAGTGG - Intergenic
1061235667 9:129341408-129341430 TGCTGCAGGGAAGGAGGGAGCGG - Intergenic
1062044301 9:134418001-134418023 GGTCCAAGGAGAGGAGGGCGAGG - Intronic
1062638801 9:137506223-137506245 TGCCGAAAGAAAGCAGGGTGTGG - Intronic
1185466143 X:355461-355483 TGTCGTAGCAACGGAGGGACCGG + Intronic
1185869217 X:3649774-3649796 GGAGGAAGGAAGGGAGGGAGGGG + Intronic
1186025132 X:5302073-5302095 GGCCGAAGAAGAGGAGGGAGAGG - Intergenic
1186164481 X:6811916-6811938 TGTAGAAAGAAAGAAGGGACTGG + Intergenic
1186447247 X:9642084-9642106 TGTCAGAGGGAAGCAGGGAGGGG + Intronic
1187196968 X:17096357-17096379 TGTTGAAAGAAAAGAGGAAGAGG + Intronic
1187344264 X:18448697-18448719 TGTTGAAAGAAGGTAGGGAGGGG + Intronic
1187522072 X:20022535-20022557 TGAGGAAGGAGAGGAGGGACGGG + Intronic
1187626272 X:21117669-21117691 AGTTGTAGGAAAAGAGGGAGTGG - Intergenic
1187817407 X:23247620-23247642 ACTCGAAGCAAAGCAGGGAGGGG - Intergenic
1188299278 X:28487599-28487621 TCTTGAAGGAATGGAGGGATAGG - Intergenic
1189546993 X:42051596-42051618 GGTGGAAGGGAAGGAGAGAGAGG - Intergenic
1190580929 X:51892968-51892990 TGGGGGAGGAAAGGAGGGAAGGG - Intronic
1190863206 X:54362750-54362772 CATGGAAGGAATGGAGGGAGAGG - Intergenic
1191793170 X:64992724-64992746 TGTGGGAGGAAAAGAGGGAATGG - Intronic
1192079174 X:68031184-68031206 TGTAGGAGGAAAGGAGGGTAAGG - Intergenic
1192869702 X:75173965-75173987 TGTGGAGGGAGAGGCGGGAGCGG - Intergenic
1192870608 X:75179885-75179907 TGTGGAGGGAGAGGCGGGAGCGG - Intergenic
1195853526 X:109307781-109307803 TGTGGTAAGAGAGGAGGGAGCGG + Intergenic
1197520530 X:127491229-127491251 TGTTTAAGGACAGGAGGGTGAGG - Intergenic
1200063658 X:153494880-153494902 GGAGGGAGGAAAGGAGGGAGGGG - Intronic
1201146157 Y:11066666-11066688 AGAGGAAGGAAGGGAGGGAGAGG + Intergenic
1201146242 Y:11066952-11066974 AGAGGAAGGAAGGGAGGGAGAGG + Intergenic
1201146520 Y:11067833-11067855 AGAGGAAGGGAAGGAGGGAGAGG + Intergenic
1201146538 Y:11067887-11067909 AGAGGAAGGAAGGGAGGGAGAGG + Intergenic
1201146544 Y:11067905-11067927 AGAGGGAGGAAAGGAGGGAGAGG + Intergenic
1201558585 Y:15290881-15290903 TGTAGAAAGAAAGAAGGGACTGG + Intergenic
1201985300 Y:19958983-19959005 TGTAAAAGGAAAAGAAGGAGAGG - Intergenic
1202093689 Y:21221397-21221419 TGTAGTAGGACAGGAAGGAGTGG + Intergenic