ID: 1020933269

View in Genome Browser
Species Human (GRCh38)
Location 7:14427337-14427359
Sequence CAAACTGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 2, 1: 41, 2: 76, 3: 79, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020933269_1020933272 4 Left 1020933269 7:14427337-14427359 CCCATATCACTATCAGCAGTTTG 0: 2
1: 41
2: 76
3: 79
4: 179
Right 1020933272 7:14427364-14427386 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580
1020933269_1020933273 5 Left 1020933269 7:14427337-14427359 CCCATATCACTATCAGCAGTTTG 0: 2
1: 41
2: 76
3: 79
4: 179
Right 1020933273 7:14427365-14427387 AGCCATTCAACAAGTCTCTAGGG 0: 234
1: 252
2: 195
3: 100
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020933269 Original CRISPR CAAACTGCTGATAGTGATAT GGG (reversed) Intronic
905002094 1:34680576-34680598 CTGTTTGCTGATAGTGATATGGG + Intergenic
906760568 1:48373410-48373432 AAAAATTCTGATAGCGATATGGG - Intronic
907964583 1:59316887-59316909 AAAACAGCTGTTAGGGATATGGG - Intronic
908812328 1:67995675-67995697 CTATCTGCTGATAGTCATTTAGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909236019 1:73153345-73153367 GAAAATGCTGATAGTGATAATGG - Intergenic
909752459 1:79179593-79179615 CAAAAGCCTGATAGTGATATGGG - Intergenic
910196023 1:84640387-84640409 CAAACTTTTGATAGTGAAATGGG - Intergenic
911154935 1:94628021-94628043 CAAACTGGTCATAGTCATTTAGG - Intergenic
911407731 1:97463659-97463681 AAAAATGCTGATAATGATAAGGG + Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
916121509 1:161532619-161532641 CTAACTGCTGTTAGGGAGATTGG - Intergenic
916453695 1:164948310-164948332 AAATCTGCTGATAGTCCTATGGG + Intergenic
916517212 1:165530477-165530499 CAAAATGTTAATAGTGATAATGG + Intergenic
919290915 1:195629236-195629258 GAATCTGCTGATAGTCATATAGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920800096 1:209178382-209178404 AAATCTGCTGATAGTCTTATAGG - Intergenic
920927780 1:210358837-210358859 CAAAATGCTGAGAGTGAAAAGGG + Intronic
921274084 1:213500292-213500314 CAAAATGAAGATGGTGATATTGG - Intergenic
921387373 1:214584236-214584258 CAAAGTGCTGCTAGTGATACTGG + Intergenic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922310700 1:224387229-224387251 AAAACTTCTGATAGTGCTGTAGG - Exonic
923440107 1:234009782-234009804 CAATCTGCTGATAGTCATATTGG - Intronic
1064548327 10:16473727-16473749 GAAGCTGCTGAAAGAGATATTGG + Intronic
1065142795 10:22735687-22735709 CAAACTGGTGGTCGTGATATAGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1068233839 10:54206400-54206422 TAAAATTCTGATAGTGATAAAGG + Intronic
1069923758 10:71833864-71833886 CAAACTGCTGATTGAGATCCTGG - Intronic
1071358323 10:84820034-84820056 TGAACTGCTTATAATGATATGGG - Intergenic
1072296103 10:94010847-94010869 CAAAATACTGATAGAAATATGGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG + Intergenic
1074683126 10:115930931-115930953 CCAACTCCTGAAAGTGAAATAGG + Intronic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078234083 11:9467930-9467952 CAAATTGCTCATCGTGACATAGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1078836509 11:15035338-15035360 CAAACTGCTGCTACTGATTCGGG - Intronic
1079084560 11:17435999-17436021 CCAACTGTAGATAGTGATGTGGG + Intronic
1079419095 11:20269396-20269418 CAAACTACGGATCGTTATATGGG + Intergenic
1079559520 11:21804561-21804583 CAAAATCCTAACAGTGATATGGG - Intergenic
1079593585 11:22212581-22212603 CACACTGCTGATAGGGTTGTGGG - Intronic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081122757 11:39286521-39286543 CAAAATACTGATAGCGATATGGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1084293157 11:68189873-68189895 CAATGTTCTGATTGTGATATGGG - Intronic
1086493864 11:87382984-87383006 CAAACTCCTTATAGGGATATAGG - Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088412526 11:109550886-109550908 GATACTGATGATAGTGATAATGG + Intergenic
1089512619 11:119009711-119009733 AACACTGTTGATAGTGGTATTGG + Intronic
1090506603 11:127321514-127321536 TAAAATGCTGATAGTGTTATGGG - Intergenic
1090644899 11:128759499-128759521 CTAAGTGATGATAGTGATTTTGG + Intronic
1091083966 11:132702405-132702427 AAATCTGCTGATAGTTTTATGGG + Intronic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1095067589 12:37798791-37798813 CAAACTGCTGAAAGAAATAAAGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1096960340 12:55570708-55570730 CAAAATACTGATAGCAATATGGG - Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097841068 12:64321815-64321837 CAAACTGCTGAAAATAATAAAGG - Intronic
1098314797 12:69182076-69182098 GAAATGGCTGATAGTGAAATGGG + Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099607848 12:84828251-84828273 CAAAATGCTAATACTGATATGGG + Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1100703583 12:97176464-97176486 TAAACTGCTGATAATGTTTTTGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101450914 12:104778102-104778124 CAAACTGCTGATTGTGGCAGAGG - Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1108085300 13:46783184-46783206 AAAAGTGCTGATAGTGAGAGAGG - Intronic
1108401142 13:50045294-50045316 CAAACTGCACATAGTTATATAGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112861455 13:103833063-103833085 CAAAATACTGATACTGATATTGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1116904509 14:50391948-50391970 CAAAGTGGAGATAATGATATGGG - Intronic
1117262639 14:54052007-54052029 CAAAGTGCTGATAGAAAAATGGG - Intergenic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123157429 14:106241927-106241949 AAAACTGCTGAGAGAGACATGGG + Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1129581015 15:76809888-76809910 AAATCTACTGATAGTGTTATGGG - Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131453657 15:92566408-92566430 CAAAATGCTCATAGAAATATGGG - Intergenic
1131587506 15:93712027-93712049 CAACCTGGTGATACTGATTTTGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1135334966 16:21593532-21593554 CAAACTGCTGAGAGCGAGAAAGG - Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1142909981 17:3080656-3080678 CAAAATGTTGAAAGTGATAATGG - Intergenic
1144647421 17:16984912-16984934 CAGACTGCAGATAGGGATTTGGG - Intergenic
1148379080 17:47179262-47179284 GAAACTGCTACTAGTGACATAGG + Intronic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149251427 17:54774561-54774583 CAATTTGCAGACAGTGATATGGG - Intergenic
1153883496 18:9441212-9441234 CAAACTGCTGTTGGTGCTATTGG - Intergenic
1154045123 18:10897081-10897103 CACACTGCTAATAGTGTTGTGGG + Intronic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1166017420 19:39993266-39993288 TAAAATGCTGATAGTGATAACGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
926185710 2:10689413-10689435 CAAACAGCTGATGGCCATATGGG + Intronic
927010715 2:18900842-18900864 CAGACTGCTGGTGGTGATGTTGG + Intergenic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929702328 2:44174389-44174411 CCAATTACTGGTAGTGATATAGG + Intronic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
930952243 2:57156868-57156890 AAAAATGCTGATAGAGATATGGG - Intergenic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
935330051 2:101970342-101970364 CAAAATGCAGATAGAAATATGGG - Intergenic
935331532 2:101981006-101981028 CAAACTGCACGAAGTGATATCGG - Intergenic
935483426 2:103621880-103621902 AAATCTGCTGATAGCCATATTGG - Intergenic
935706431 2:105861465-105861487 CTACCTGCTGAAAGTGATAGTGG + Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937015416 2:118601052-118601074 CACACTGCTGATAGCAATACTGG + Intergenic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939217007 2:139251333-139251355 CAAACTGCTGTCAGTCATCTGGG + Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939841251 2:147189752-147189774 AAACCTGCTGATAATCATATGGG - Intergenic
940261872 2:151789479-151789501 CAAACTGCTGATGTTTACATTGG - Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941256590 2:163239938-163239960 AAATCTACTGATAGTCATATAGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
942778641 2:179614410-179614432 CAAACTGCTAAAAGTCATCTAGG - Intronic
943223583 2:185140695-185140717 CAAAAAGCCGATAGTGATGTGGG - Intergenic
943869299 2:192973631-192973653 TAAACTGCTCATAATTATATTGG + Intergenic
945189228 2:207168620-207168642 CAGACGGCTGATAGTTACATAGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
1170304838 20:14926919-14926941 CAAATTGATGATAATTATATTGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171217840 20:23365128-23365150 AAAACTGCTGAGGGTGATGTGGG + Exonic
1173246026 20:41338187-41338209 CAAACAGCTGCCAGTGATATAGG + Intergenic
1173323519 20:42010746-42010768 CAAAATGCTGACAGTGATAATGG - Intergenic
1174755696 20:53156199-53156221 CCCATTGCTGATAGAGATATGGG - Intronic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177330943 21:19661657-19661679 AAAACTGCTGATGGTATTATGGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177604557 21:23360804-23360826 CAAAACGCTGATAGTGATACGGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1177992730 21:28058182-28058204 CTAAATGCTGACAATGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178149665 21:29779842-29779864 CAAAATGTAGATAGTGAGATTGG + Intronic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1181505233 22:23351637-23351659 TTAATTGCTCATAGTGATATAGG - Intergenic
1184317211 22:43704156-43704178 AAATCTGCTGATAGTCATGTTGG - Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959548626 3:107627699-107627721 CTCACTATTGATAGTGATATAGG + Intronic
959699666 3:109286806-109286828 CCAACTGCTGTTAGTCACATTGG - Intergenic
962139564 3:132774272-132774294 CAATATCTTGATAGTGATATGGG - Intergenic
962579206 3:136782491-136782513 CCAACTGCTGGGAGTGGTATTGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963433805 3:145242550-145242572 CAACATGCTGATAGTGATAAGGG - Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964076786 3:152701462-152701484 CAGAATGCTCATAGTGATAGTGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
965232713 3:166073438-166073460 AAAAATGCTGATAGAAATATGGG - Intergenic
965326460 3:167310228-167310250 CAAAATGCTTATAGTGATAATGG - Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966250712 3:177862204-177862226 AAGACTGCTGATAGTCATATTGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974724105 4:65777061-65777083 CAAAATTCTGATAATGATACGGG + Intergenic
975891904 4:79039754-79039776 CAGACTGCTTATATTGATATTGG + Intergenic
976979020 4:91202035-91202057 AAAAGTGCTAAAAGTGATATTGG - Intronic
977045689 4:92065999-92066021 CAATCTGCTAATAGTTTTATAGG + Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977734327 4:100394664-100394686 CAAACTGTTTACAGTGAGATAGG + Intergenic
978245601 4:106568838-106568860 CAAGCTGCTCTTAGTGATTTGGG - Intergenic
979060987 4:116059935-116059957 CAAAGTGCTGATAGTGATGTGGG - Intergenic
979125708 4:116969397-116969419 CAAAATGCTAATAGTGCTATTGG - Intergenic
979423857 4:120540163-120540185 CAAAATGCTTATAGTCATGTTGG - Intergenic
979942173 4:126775335-126775357 CAAAACACTGAAAGTGATATTGG - Intergenic
980731818 4:136833585-136833607 CAAAAGCCTGGTAGTGATATGGG + Intergenic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983428920 4:167622588-167622610 CAAACTGGTAAATGTGATATTGG - Intergenic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983915022 4:173282537-173282559 CTAACTGCTGTTAGGGAGATTGG + Intronic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
984512358 4:180694017-180694039 CAAAATACTAATAGTGATATAGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
987459955 5:18197400-18197422 CAAAATGCTGAAAGAAATATGGG + Intergenic
987533209 5:19148797-19148819 CAAAATGCTGATAGTGACGAGGG - Intergenic
987918647 5:24249435-24249457 CAAAATGCTGACAGTGACATGGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988076760 5:26363821-26363843 CAATATGCTGATAGTGATAAGGG + Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
989265900 5:39473541-39473563 AAAACTGCTGATAGTACCATGGG - Intergenic
989501963 5:42178059-42178081 TGAAATGCTAATAGTGATATGGG - Intergenic
989625155 5:43422541-43422563 AAAGCTGATGATGGTGATATGGG - Intergenic
989677025 5:43984164-43984186 CAAAATGCTGACAGTGACATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990075844 5:51844583-51844605 CAAAATGCCAATAGGGATATAGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991447245 5:66713305-66713327 TAATCTGCTGATGGTGATCTGGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993792625 5:92225203-92225225 CAAAATACTGATAGTGAGATGGG - Intergenic
993885372 5:93409607-93409629 CAAACTCCTGGTCGTGATACTGG - Intergenic
993937614 5:94023281-94023303 TATGGTGCTGATAGTGATATGGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994810690 5:104515217-104515239 CAAACTCCTGTTTGTGAAATTGG - Intergenic
994849569 5:105036671-105036693 CAAAACCCTGATAGTGATATGGG - Intergenic
994945915 5:106391502-106391524 GTAATAGCTGATAGTGATATAGG - Intergenic
995211964 5:109550959-109550981 CAAAATGCTGATAGCCATATGGG + Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
999083282 5:148864281-148864303 CAAGCTGCTAATAGTGACCTTGG + Intergenic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1003798236 6:9630197-9630219 CCAAATGCTGATAGTGACATGGG + Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG + Intergenic
1008002245 6:46372801-46372823 CAGACTTCTGATAGTTAAATGGG - Intronic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008953573 6:57188669-57188691 CCCATTGCTGATAGTGACATAGG - Exonic
1009474925 6:64078779-64078801 CAAGCTGATGATAGTGCCATAGG - Intronic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009732082 6:67621728-67621750 AAAAATACTGATAATGATATGGG + Intergenic
1010226169 6:73491441-73491463 CAAACTGATAAAAATGATATAGG - Intronic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011026893 6:82879263-82879285 CAAACTGATGATAGTCAAAGGGG - Intergenic
1011392124 6:86865755-86865777 AATTCTGCTGATAGTCATATTGG - Intergenic
1012084365 6:94805243-94805265 CAAAGTCCTTATAATGATATAGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015302150 6:131666215-131666237 AAACCTGCTGATAGTTTTATAGG + Intronic
1016465415 6:144320378-144320400 CAGGCTGCTGATAGTGAGAGGGG + Intronic
1018381452 6:163261490-163261512 CAAATTGCTGCTGGTGATAATGG - Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1022947858 7:35305209-35305231 CAAACTGCTTATAATAATGTGGG + Intergenic
1023253448 7:38290249-38290271 CTAATTGCTGACACTGATATGGG + Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024897209 7:54273922-54273944 AAATCTGCAGATAGTCATATTGG + Intergenic
1027056596 7:75053717-75053739 CCAACAGCTGATGGTGACATGGG - Intronic
1031261928 7:119532438-119532460 CAAAATTCTGATAGTGATGTGGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032873713 7:136013978-136014000 CAAACTGGGGATAGGGTTATTGG + Intergenic
1033317412 7:140309127-140309149 CAAACTGCTGAGTGGGAAATGGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034942778 7:155242333-155242355 AAAACTGCTGATCCTGAAATAGG - Intergenic
1036221548 8:6925173-6925195 CAAACTGGAGACAGTCATATGGG - Intronic
1036893878 8:12615122-12615144 CAAAATGCTGATGGTTATATGGG - Intergenic
1037596726 8:20360550-20360572 CAATCTGCTGATAATGGTCTTGG + Intergenic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1039646370 8:39288764-39288786 AAATCTGCTGATAGTTGTATTGG + Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040456837 8:47606565-47606587 CAAACTCCTGATGGTGAGAATGG + Intronic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040977175 8:53206361-53206383 CAGGCTGCAGAGAGTGATATTGG + Intergenic
1041447793 8:57971807-57971829 CCAACTGCTGATAGACATCTGGG + Intergenic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044105969 8:88207523-88207545 CAAAGTGCTGCTAGTGATGCTGG + Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044326821 8:90868437-90868459 CAAAATGTCCATAGTGATATGGG + Intronic
1044646506 8:94449251-94449273 CAACCTGATGATATGGATATTGG - Intronic
1045050589 8:98320677-98320699 CAAAATGCTGATAGCAATACGGG - Intergenic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046087159 8:109452274-109452296 CAAACTGGTAATAGTGCTGTTGG + Exonic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046188479 8:110756410-110756432 CAAACTGCTGATAGGGACAACGG - Intergenic
1046571603 8:115973137-115973159 AAAAGTGCTGATAATCATATAGG + Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1047915867 8:129583202-129583224 CAGACAGCTGTTAATGATATCGG - Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050549264 9:6735171-6735193 CAAACTGCTTAGTGTGAAATTGG + Intronic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050890625 9:10819845-10819867 AAAAATGCTGAGAGTGATATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1050956921 9:11675384-11675406 AAATCTGCTGATAGTCTTATGGG + Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052635430 9:31097742-31097764 CCAAATGCTGACAATGATATAGG + Intergenic
1053369888 9:37551855-37551877 CTAACTGCTTATAGTAAAATGGG - Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1055237056 9:74134598-74134620 TAACCTAGTGATAGTGATATCGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1059570175 9:115425833-115425855 CTAACTGCTGATAATGATATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059917171 9:119116958-119116980 CAAAATGTTGATAGAAATATGGG + Intergenic
1061938184 9:133870221-133870243 GAAACTTCTGATATTGATGTTGG - Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186751513 X:12626456-12626478 AAATCTGCTGATAGTTGTATTGG - Intronic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188749163 X:33884559-33884581 CAAAATGCTGATGGTTATATGGG + Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189872161 X:45395227-45395249 AAATATGCTGATAGTCATATTGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193232355 X:79062706-79062728 CACACTGCTGATAAAGACATTGG - Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193687500 X:84595605-84595627 CAGACTGCTGAGAGTGAGAGAGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1194646438 X:96464011-96464033 CAAACTAATTACAGTGATATTGG + Intergenic
1196028954 X:111074781-111074803 CAAAATGCTGATGGAGATGTGGG + Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197392302 X:125882939-125882961 CAAAATGCAGACAGTAATATGGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199309507 X:146306828-146306850 AAAACTGCTGATGGCAATATAGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic