ID: 1020933269

View in Genome Browser
Species Human (GRCh38)
Location 7:14427337-14427359
Sequence CAAACTGCTGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020933269_1020933273 5 Left 1020933269 7:14427337-14427359 CCCATATCACTATCAGCAGTTTG No data
Right 1020933273 7:14427365-14427387 AGCCATTCAACAAGTCTCTAGGG 0: 234
1: 252
2: 195
3: 100
4: 232
1020933269_1020933272 4 Left 1020933269 7:14427337-14427359 CCCATATCACTATCAGCAGTTTG No data
Right 1020933272 7:14427364-14427386 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020933269 Original CRISPR CAAACTGCTGATAGTGATAT GGG (reversed) Intronic