ID: 1020935709

View in Genome Browser
Species Human (GRCh38)
Location 7:14461133-14461155
Sequence ACCTTTCCTGCTCTTTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8256
Summary {0: 1, 1: 0, 2: 26, 3: 619, 4: 7610}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020935709_1020935712 16 Left 1020935709 7:14461133-14461155 CCACAGGAAAGAGCAGGAAAGGT 0: 1
1: 0
2: 26
3: 619
4: 7610
Right 1020935712 7:14461172-14461194 AACATCACAATTAAAAGCACTGG 0: 1
1: 117
2: 105
3: 92
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020935709 Original CRISPR ACCTTTCCTGCTCTTTCCTG TGG (reversed) Intronic
Too many off-targets to display for this crispr