ID: 1020940109

View in Genome Browser
Species Human (GRCh38)
Location 7:14522573-14522595
Sequence TATGGTAGTTCAACCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 53}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020940109_1020940119 6 Left 1020940109 7:14522573-14522595 CCTGTCCTGGTTGAACTACCATA 0: 1
1: 0
2: 0
3: 8
4: 53
Right 1020940119 7:14522602-14522624 CAACTGGAAAGGGGGTGGATGGG 0: 1
1: 0
2: 2
3: 41
4: 413
1020940109_1020940117 1 Left 1020940109 7:14522573-14522595 CCTGTCCTGGTTGAACTACCATA 0: 1
1: 0
2: 0
3: 8
4: 53
Right 1020940117 7:14522597-14522619 TGACACAACTGGAAAGGGGGTGG 0: 1
1: 0
2: 3
3: 23
4: 286
1020940109_1020940118 5 Left 1020940109 7:14522573-14522595 CCTGTCCTGGTTGAACTACCATA 0: 1
1: 0
2: 0
3: 8
4: 53
Right 1020940118 7:14522601-14522623 ACAACTGGAAAGGGGGTGGATGG No data
1020940109_1020940115 -3 Left 1020940109 7:14522573-14522595 CCTGTCCTGGTTGAACTACCATA 0: 1
1: 0
2: 0
3: 8
4: 53
Right 1020940115 7:14522593-14522615 ATATTGACACAACTGGAAAGGGG 0: 1
1: 0
2: 3
3: 24
4: 230
1020940109_1020940116 -2 Left 1020940109 7:14522573-14522595 CCTGTCCTGGTTGAACTACCATA 0: 1
1: 0
2: 0
3: 8
4: 53
Right 1020940116 7:14522594-14522616 TATTGACACAACTGGAAAGGGGG No data
1020940109_1020940114 -4 Left 1020940109 7:14522573-14522595 CCTGTCCTGGTTGAACTACCATA 0: 1
1: 0
2: 0
3: 8
4: 53
Right 1020940114 7:14522592-14522614 CATATTGACACAACTGGAAAGGG 0: 1
1: 0
2: 2
3: 12
4: 255
1020940109_1020940111 -10 Left 1020940109 7:14522573-14522595 CCTGTCCTGGTTGAACTACCATA 0: 1
1: 0
2: 0
3: 8
4: 53
Right 1020940111 7:14522586-14522608 AACTACCATATTGACACAACTGG No data
1020940109_1020940120 18 Left 1020940109 7:14522573-14522595 CCTGTCCTGGTTGAACTACCATA 0: 1
1: 0
2: 0
3: 8
4: 53
Right 1020940120 7:14522614-14522636 GGGTGGATGGGAGCATGCCCAGG 0: 1
1: 0
2: 2
3: 24
4: 350
1020940109_1020940113 -5 Left 1020940109 7:14522573-14522595 CCTGTCCTGGTTGAACTACCATA 0: 1
1: 0
2: 0
3: 8
4: 53
Right 1020940113 7:14522591-14522613 CCATATTGACACAACTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020940109 Original CRISPR TATGGTAGTTCAACCAGGAC AGG (reversed) Intronic
901296676 1:8166210-8166232 TATGGGAGTTCACTCAGCACAGG + Intergenic
901348762 1:8572699-8572721 AATGGAAGTTCTACCAGGACTGG - Intronic
912106909 1:106289923-106289945 TATGTTAGTTAAACTAGGTCAGG - Intergenic
916398301 1:164416276-164416298 ACTGGTAGGTCCACCAGGACAGG + Intergenic
916879955 1:169010953-169010975 TATGGTAATTTAACCAGCCCAGG + Intergenic
919776790 1:201199445-201199467 CATGGTAGCTCAACCAGGCAGGG - Intronic
921730632 1:218574129-218574151 TATGGGATTTCATCCTGGACAGG - Intergenic
1068935524 10:62632260-62632282 TATGTTTGTTCAAGCAAGACAGG - Intronic
1070779965 10:79131794-79131816 TATGATTGTTCCACCAGAACAGG - Intronic
1084233754 11:67772470-67772492 TATTTTATTTCAAACAGGACTGG + Intergenic
1084291421 11:68171933-68171955 AATGGAAACTCAACCAGGACAGG + Intronic
1086327151 11:85713846-85713868 GAAGGGGGTTCAACCAGGACTGG - Intronic
1086849852 11:91796691-91796713 TAAAATAGTTCAACCAGGCCAGG - Intergenic
1092127757 12:6086909-6086931 AATGTTAGCTCAAGCAGGACAGG + Intronic
1092915410 12:13184763-13184785 CAGGGGAGATCAACCAGGACAGG + Intergenic
1100733334 12:97498314-97498336 TATGGTGGTTGAACCAGAATTGG + Intergenic
1107670987 13:42746097-42746119 CATGGTTGTTCATACAGGACTGG + Intergenic
1125398628 15:39276395-39276417 CTTGGTAGTTCTACCAGGGCAGG + Intergenic
1126819795 15:52491013-52491035 TATTGTTGTACAACCAGGCCAGG - Intronic
1148087292 17:45001804-45001826 TTTGGTAGTTCAACAAGGATGGG + Intergenic
1155181336 18:23350804-23350826 TGTGATAGTTCAACCAGAGCAGG - Intronic
929178550 2:39007949-39007971 TGTGGTATTTGAACCAAGACTGG + Intronic
931086507 2:58836971-58836993 TCTGGTGGCTCAACAAGGACTGG - Intergenic
939678951 2:145107011-145107033 TCTGGTAGCTAGACCAGGACAGG + Intergenic
943566232 2:189520086-189520108 AATGGCAGCTCAAGCAGGACAGG + Intergenic
946183626 2:217964448-217964470 TAAGGTGGTGGAACCAGGACCGG - Intronic
1170671133 20:18434739-18434761 TGTGGTAGTTCCACCAGGGCAGG + Intronic
1177027515 21:15938019-15938041 TATGGTAATTCAACATGGAAAGG - Intergenic
1177661730 21:24092983-24093005 CATGTTAGATCAACCAGGTCAGG + Intergenic
1178420651 21:32440507-32440529 TATTTTATTTCAAACAGGACTGG - Intronic
1179288206 21:39996181-39996203 AATGATAATTAAACCAGGACGGG - Intergenic
953112978 3:39961515-39961537 TCTGGGAGTTCAACCAGGAAAGG + Intronic
953302438 3:41791844-41791866 TATGATAGTTCCACAAGGAAAGG - Intronic
956002250 3:64741766-64741788 TATGTTAGTCCAACCAGAAGTGG - Intergenic
957051049 3:75412388-75412410 TATTTTATTTCAAACAGGACTGG + Intergenic
961883343 3:130078810-130078832 TATTTTATTTCAAACAGGACTGG + Intergenic
963095462 3:141534240-141534262 TATGGTTGATTAACCAGGCCGGG + Intronic
963238333 3:142977155-142977177 AATGGTAGCGCAACCAGGACAGG - Intronic
964200468 3:154113413-154113435 TATGGTAGTTCTATAAGTACCGG + Intergenic
965950577 3:174303525-174303547 AATGGTAGTAAAGCCAGGACTGG - Intergenic
969821396 4:9723286-9723308 TATTTTATTTCAAACAGGACTGG - Intergenic
971264659 4:25087359-25087381 TTTGGAAGTTCAAGCAGGGCTGG + Intergenic
972850073 4:43037719-43037741 TATAGTAGTGCAATCAGGGCTGG + Intergenic
981581866 4:146257507-146257529 TAGGGTAGTTCAGCCAGTGCTGG - Intronic
987171326 5:15261483-15261505 TGTAGTAGCTCAACCAGGGCAGG + Intergenic
999854961 5:155584223-155584245 AATGGTGGTAAAACCAGGACTGG - Intergenic
1000506563 5:162127471-162127493 TATCATAGTTCAACCATCACTGG + Intronic
1000704738 5:164496680-164496702 TATAATTTTTCAACCAGGACAGG + Intergenic
1002133173 5:177093530-177093552 TATGGGAGTTCCCCCGGGACAGG + Exonic
1003773185 6:9330765-9330787 GATGGTAGTGCTACTAGGACAGG - Intergenic
1013094349 6:106931018-106931040 CATGGTATTTCAGGCAGGACAGG + Intergenic
1016095409 6:140031161-140031183 TGTGGTAGCTCAACTAGGTCTGG - Intergenic
1020940109 7:14522573-14522595 TATGGTAGTTCAACCAGGACAGG - Intronic
1024559536 7:50631695-50631717 TAGGGTAGGTCACCCAGAACAGG - Intronic
1030237434 7:107280487-107280509 TATGGTATTTCAACCGGGAATGG + Intronic
1031442664 7:121812702-121812724 TATGTCAGTTCATCCAGGCCTGG + Intergenic
1055201525 9:73668267-73668289 TATAGTAGTTCAACCAGGGTAGG - Intergenic
1058028614 9:100170810-100170832 TATGGAAATACAACCATGACAGG + Intronic
1060951677 9:127608051-127608073 TAAGGTACTTTATCCAGGACTGG - Intergenic
1187267489 X:17748227-17748249 GATGGTAGTTCCTCTAGGACAGG + Intronic
1199372435 X:147066567-147066589 TATAGTAGTTCAACCAGGGTGGG - Intergenic
1201934866 Y:19398452-19398474 TATGGTACTTCTAATAGGACAGG + Intergenic