ID: 1020941574

View in Genome Browser
Species Human (GRCh38)
Location 7:14545645-14545667
Sequence CCTGCTGAGCAGCTATTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020941574_1020941576 -2 Left 1020941574 7:14545645-14545667 CCTCACAATAGCTGCTCAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1020941576 7:14545666-14545688 GGATTTAAGAATTGCTACACTGG 0: 1
1: 0
2: 0
3: 15
4: 113
1020941574_1020941579 9 Left 1020941574 7:14545645-14545667 CCTCACAATAGCTGCTCAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1020941579 7:14545677-14545699 TTGCTACACTGGGATCTGCTGGG No data
1020941574_1020941578 8 Left 1020941574 7:14545645-14545667 CCTCACAATAGCTGCTCAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1020941578 7:14545676-14545698 ATTGCTACACTGGGATCTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 108
1020941574_1020941577 -1 Left 1020941574 7:14545645-14545667 CCTCACAATAGCTGCTCAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1020941577 7:14545667-14545689 GATTTAAGAATTGCTACACTGGG 0: 1
1: 0
2: 0
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020941574 Original CRISPR CCTGCTGAGCAGCTATTGTG AGG (reversed) Intronic
900105868 1:980769-980791 CCTGCTGACCGGCTGCTGTGTGG + Exonic
900808345 1:4782350-4782372 CCTGCTGACCAGTTCTAGTGAGG + Intronic
902312079 1:15588746-15588768 CCTTCTGAGTAGCTAGTGAGAGG - Intronic
903025958 1:20430218-20430240 CCTGCTCAGAGGCTGTTGTGAGG - Intergenic
903621375 1:24700770-24700792 GCTGCAGAGCAGCCATTCTGGGG - Intergenic
903998981 1:27327243-27327265 CTTAATGAGGAGCTATTGTGAGG - Intronic
904049539 1:27630970-27630992 CCTTCTGAGTAGTTGTTGTGAGG + Intronic
905947544 1:41916763-41916785 CCTGCTGAGCAGCCAGTGTAGGG - Intronic
906952626 1:50347172-50347194 TTTACTGAGCAGCTATTATGTGG + Intergenic
910427112 1:87129280-87129302 CCTCATGAACACCTATTGTGAGG + Intronic
913088193 1:115458256-115458278 CAGGATGAGCAGCTATTGGGAGG + Intergenic
917245180 1:172993173-172993195 CCTGCTTAGCAGTTATTGGGAGG + Intergenic
920045567 1:203130054-203130076 CCTGCTGGGACGCTCTTGTGAGG + Intronic
923091029 1:230741449-230741471 CCTGTGGAGCAGCGAGTGTGGGG + Intergenic
923108426 1:230871756-230871778 CCTGCAGAGCCGATCTTGTGTGG - Intergenic
923111191 1:230891602-230891624 CCTGCTGCGCAGAGATTGTCTGG - Intergenic
1064280155 10:13944145-13944167 CCTGCTGTGCAGCCAGTCTGTGG - Intronic
1065827053 10:29582305-29582327 CCTGGAGAACAGCTCTTGTGAGG + Intronic
1065950797 10:30648875-30648897 CCTGGAGAACAGCTCTTGTGAGG - Intergenic
1067306229 10:45066511-45066533 TCTTCTTAGCAGCTATTGGGAGG + Intergenic
1071950523 10:90698366-90698388 CCAGCAGACCAGCTAGTGTGGGG + Intergenic
1072114471 10:92356653-92356675 CCTGTTGAGCATCTGTAGTGTGG - Intergenic
1073535743 10:104275204-104275226 CCTGCAGAGCAGCGATGGAGGGG - Exonic
1074123134 10:110508139-110508161 CCTGGGGAGCAGAAATTGTGTGG - Intronic
1075279306 10:121126183-121126205 CCTGCTGAAGAGCTCTGGTGAGG - Intergenic
1075922737 10:126226369-126226391 CCTGGTGAGGAGCTTCTGTGTGG + Intronic
1076312829 10:129520776-129520798 CCTGCAGAGCCCCTATGGTGCGG + Intronic
1077573010 11:3355413-3355435 CCTGGTGAGCAGCTATGGAAGGG + Intronic
1078622484 11:12921864-12921886 CCTGCTGAGCTGCTCTTTTGTGG + Intronic
1080368590 11:31608516-31608538 CCTGGTGAGCAGCTATGGAAGGG + Intronic
1081872845 11:46391262-46391284 CCTGCTGAGCCGCCAGTGGGAGG + Intergenic
1082691336 11:56308277-56308299 CCAGCAGAGCAGCTATGATGAGG + Intergenic
1084322866 11:68383428-68383450 CCTGCTTAACAGCCACTGTGGGG - Intronic
1086382920 11:86276453-86276475 CCTGTTGAGTACCTACTGTGTGG + Intronic
1086529446 11:87767024-87767046 CCTACTTAGTAGCTATTGTATGG - Intergenic
1087134737 11:94705175-94705197 TCTGCTGAGCACCTACTGTATGG + Intergenic
1087597584 11:100273169-100273191 CCAGAGGAGAAGCTATTGTGAGG - Intronic
1088896443 11:114082340-114082362 CCTACAGTGCAGTTATTGTGTGG + Intronic
1092490924 12:8944243-8944265 CCTGCTGCTCAGCAATTGTATGG - Intronic
1093647536 12:21604801-21604823 CTTTCTGGGCAGGTATTGTGAGG + Exonic
1094224816 12:28033196-28033218 CCTTCTAAGCAGCTGGTGTGGGG - Intergenic
1094526832 12:31236822-31236844 CCTCCTGAGCAGATACTGTGTGG - Intergenic
1095713532 12:45316188-45316210 CCTGTTGAGCAGGTACTGTTGGG + Intronic
1095762129 12:45851469-45851491 CCAGCTCAGCAGCTATTGGTTGG + Exonic
1098861595 12:75716920-75716942 CCTGCTGAGTAGCAACGGTGGGG - Intergenic
1100125437 12:91419161-91419183 CCTGCTCAGCTGCCATGGTGTGG - Intergenic
1101210636 12:102532110-102532132 CCTCCTGTGCAGCTGCTGTGTGG - Intergenic
1101977301 12:109370793-109370815 TCTGCTGAGCACCAATTATGTGG + Intronic
1102344370 12:112149833-112149855 CCTCCTGGGCAGCTCTGGTGAGG - Exonic
1103867714 12:124066311-124066333 CCTGATCAGCAGAAATTGTGAGG - Intronic
1104449892 12:128860547-128860569 CCTGCTGGGCAGCCCTTGAGGGG + Intronic
1104763243 12:131310867-131310889 TCTGCTGAGGAGCTGTAGTGTGG + Intergenic
1104816255 12:131647203-131647225 TCTGCTGAGGAGCTGTAGTGTGG - Intergenic
1106083468 13:26519738-26519760 CCTGCAGAGCAGCCACTGGGAGG - Intergenic
1106215735 13:27697264-27697286 TCTCCTGAGCAGCTATTCTCTGG - Intergenic
1106595190 13:31129588-31129610 CCTCCTGCCCTGCTATTGTGTGG - Intergenic
1109788325 13:67212748-67212770 CCTGCTGAGCACTTATTTGGAGG - Intronic
1111054904 13:82936905-82936927 TGTGCTGAGCAGTTATTCTGTGG - Intergenic
1111571745 13:90097034-90097056 CATGCTTTGCAGATATTGTGGGG - Intergenic
1112656902 13:101461300-101461322 AGAGCTGAGCAGCTTTTGTGGGG - Intronic
1114491027 14:23102097-23102119 GCTGCAGAGGAGCTGTTGTGGGG - Intergenic
1115405796 14:33014839-33014861 CCTGCTGTGCAGCTCTGGTGAGG - Intronic
1119331723 14:73799968-73799990 CCTGCAGTGGAGTTATTGTGAGG - Intergenic
1119766833 14:77195773-77195795 CCAGCTGAGCAGCAGCTGTGGGG - Intronic
1119999796 14:79289906-79289928 CTTGCTTACCAGCTATTGAGTGG + Intronic
1123414757 15:20087181-20087203 CCAGTTGAGTAGCTATTTTGCGG + Intergenic
1123524099 15:21094295-21094317 CCAGTTGAGTAGCTATTTTGCGG + Intergenic
1126323633 15:47451064-47451086 CCTGCTTTGCAGCGAATGTGAGG + Intronic
1129229936 15:74191467-74191489 GCTGCAGAGCAGCTACTCTGAGG - Exonic
1130134148 15:81167797-81167819 CCTACTGGACAGCCATTGTGAGG - Intronic
1131052944 15:89360104-89360126 CCTGCAGGGCAGATTTTGTGGGG - Intergenic
1131192056 15:90324708-90324730 CCTGATTAGCAGCAGTTGTGAGG - Intergenic
1131865350 15:96702815-96702837 CCTCCTGAGTTGCTCTTGTGTGG + Intergenic
1140510213 16:75502128-75502150 CCTGCTGGACTGCTAATGTGGGG + Intergenic
1140515977 16:75542184-75542206 CCTGCTGGACTGCTAATGTGGGG + Intronic
1140956522 16:79871427-79871449 CCTTCTGAGCAGAGGTTGTGAGG + Intergenic
1143463088 17:7116329-7116351 CTTGTTGAGCAGCTACTGTGTGG - Intergenic
1143733335 17:8893778-8893800 CCTGCAGAGAAGCTGTTCTGTGG + Intronic
1145732764 17:27204483-27204505 ACTGCTGAGCAGCAGTAGTGGGG + Intergenic
1153037003 18:772961-772983 CCTGCTGACCAGTTATGGTTTGG + Intronic
1153166104 18:2263528-2263550 GCTGCTTAGCAGCTACAGTGTGG - Intergenic
1156716172 18:40013637-40013659 CCAGCTGATCAGCTATAGTGTGG + Intergenic
1158407001 18:57168650-57168672 CCTGCTGGGCAGCCATTATCTGG + Intergenic
1158760659 18:60381787-60381809 CCTGCTGCACAGTTATTGTCTGG + Intergenic
1160187934 18:76689920-76689942 CCTGCTTAGCAGCTAGTTTTTGG - Intergenic
1162894144 19:13754899-13754921 CTTACTGAGCACCTACTGTGTGG - Intronic
925415402 2:3666877-3666899 CCTGCTGAGCAGCACAGGTGTGG - Intronic
926059362 2:9795545-9795567 CCTGCTGAGCAGCCAGCATGAGG - Intergenic
932576847 2:72967232-72967254 CTTACTGAGCATCTATTGTGTGG + Intronic
934949195 2:98564747-98564769 CCTGCTGAGCACCTACGGTGAGG + Exonic
935416902 2:102828715-102828737 TCTACTGAGCTCCTATTGTGGGG - Intronic
937050100 2:118881661-118881683 CCTGTTGAGCAGCTACCCTGCGG - Intergenic
937218060 2:120325155-120325177 CCTGCACAACAGCTGTTGTGAGG - Intergenic
939728868 2:145757010-145757032 CCTGCTCAGTGTCTATTGTGTGG + Intergenic
941856833 2:170239887-170239909 CCTGCTGACCCGCTGATGTGGGG - Intronic
948779644 2:240310799-240310821 CCGGCAGAGCAGCTTTGGTGTGG - Intergenic
1169870757 20:10245723-10245745 CATGTTGAGCACTTATTGTGTGG - Intronic
1173869177 20:46330953-46330975 CATGCTGAGCAGCATCTGTGTGG + Intergenic
1175247607 20:57591207-57591229 CCAACTGAGCAGCTCTTCTGTGG + Intergenic
1175733932 20:61372413-61372435 CCTGCTGAGCAGCTGTACTGTGG + Intronic
1179730012 21:43362432-43362454 CTCGCTGAGCAGCTGATGTGGGG - Intergenic
1181971743 22:26695802-26695824 CGTGCTGAGGAGCTACTGGGTGG + Intergenic
1183687174 22:39367849-39367871 CCTGGTGAGCTGCTGTGGTGGGG - Intronic
949306953 3:2652476-2652498 ACTGCTGTGCAGCTGCTGTGGGG + Intronic
951627675 3:24683837-24683859 CCTCCTCTCCAGCTATTGTGAGG - Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953455493 3:43037403-43037425 CCTCCAGAGCAGCTTCTGTGTGG - Intronic
953604807 3:44404926-44404948 CCAGCAGAGCTGCTACTGTGAGG - Intronic
954360199 3:50118090-50118112 CTTGCTGAGCAGGCATTGAGGGG + Intronic
956776296 3:72568180-72568202 GCTGCTTAGCAACTCTTGTGCGG - Intergenic
958680456 3:97324193-97324215 CCTGCTTAACAGATATTTTGAGG + Intronic
960572799 3:119202152-119202174 CCTGCTTAGCTACTGTTGTGGGG - Intronic
962187315 3:133273485-133273507 CCTGCTGAGTACTTACTGTGGGG - Intronic
964546237 3:157837004-157837026 CCTGCTGAGTACTTATTTTGAGG - Intergenic
964899833 3:161645068-161645090 GTTCCTGAGCAACTATTGTGGGG + Intergenic
967266191 3:187694372-187694394 CATGGTGACCAACTATTGTGGGG + Intergenic
968502661 4:958295-958317 CCTGCTGAGCAGGTTCAGTGTGG + Exonic
969660997 4:8527486-8527508 CGTGCTGAGCAGCATCTGTGTGG + Intergenic
969670357 4:8586805-8586827 CCTACTGAGCACCTGCTGTGTGG + Intronic
971083079 4:23238006-23238028 CTTGCTGAGCAGCTCTTGAAAGG - Intergenic
975709084 4:77141168-77141190 CTTAATGAGCAACTATTGTGTGG - Intergenic
977516602 4:98027984-98028006 CCTGTAGAGGAGCTGTTGTGTGG - Intronic
985319794 4:188697883-188697905 ACTGTTGAGCAGCTATTTTTGGG - Intergenic
986565323 5:9107848-9107870 CCTCCAGAGCATCTATTGTATGG + Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
994127834 5:96189476-96189498 CCTGCTGAGCAAATATTCAGTGG + Intergenic
1001015486 5:168137151-168137173 CCTCCTGGGCAGCAATTATGTGG - Intronic
1001337090 5:170807952-170807974 CCTGCTGTGCTTCTATTATGGGG - Intronic
1001490559 5:172151798-172151820 GCTGCTGAGCAGCTACTAAGTGG - Intronic
1001859336 5:175039655-175039677 CCTGCTGATCAGACATTTTGAGG + Intergenic
1001892134 5:175348438-175348460 CCTACTGAGAAGCTGCTGTGAGG + Intergenic
1010357919 6:74956737-74956759 CATGCTGAACATCGATTGTGTGG - Intergenic
1011246029 6:85322185-85322207 GCTGCTGAGCAGCTAGTGAGAGG + Intergenic
1019911951 7:4106149-4106171 CCTTCTGAGCAGCGAGTGTCTGG - Intronic
1019918527 7:4148759-4148781 CCAGCTGAGCAGCTATCTTAAGG - Intronic
1020941574 7:14545645-14545667 CCTGCTGAGCAGCTATTGTGAGG - Intronic
1022506791 7:30912542-30912564 CCTGCAGGGCATCTATTATGGGG + Intronic
1023166093 7:37345133-37345155 CCTGCTGAGAAGCTAATCAGTGG + Intronic
1025875837 7:65478986-65479008 CCTGGTGAGCAGCTATGGCAGGG - Intergenic
1028440195 7:90850764-90850786 CCTGTTAAGCAGCTGTTGAGAGG + Intronic
1030822056 7:114106030-114106052 CCTGCTGAGCCTCCACTGTGTGG - Intronic
1031467421 7:122129396-122129418 CCTCCTGAGCTTTTATTGTGTGG + Exonic
1034050949 7:147983984-147984006 CCTGCTAAGCAGTTTTTTTGTGG - Intronic
1035401129 7:158566509-158566531 CCTGCAGAGTACCTTTTGTGCGG - Intronic
1046187872 8:110746627-110746649 CCTGCTGTGCACGTATTGTCAGG - Intergenic
1046223876 8:111250968-111250990 TCTGCTGTGCAGTTATTATGGGG - Intergenic
1047506780 8:125486386-125486408 CTTGCTCAGCAGCTATTTTAGGG - Intergenic
1049372949 8:142276371-142276393 CCTCCTGAGTGGCAATTGTGGGG - Intronic
1049668539 8:143859417-143859439 CCTGCTGAGCAGATACCGGGCGG - Exonic
1049668955 8:143861019-143861041 CCTGCTGAGCAGATACCGGGCGG - Exonic
1049669370 8:143862621-143862643 CCTGCTGAGCAGATACCGGGCGG - Exonic
1049669781 8:143864214-143864236 CCTGCTGAGCAGATACCGGGCGG - Exonic
1049670197 8:143865822-143865844 CCTGCTGAGCAGATACCGGGCGG - Exonic
1051149755 9:14067585-14067607 CTTGCTGAGCAGATATCCTGAGG - Intergenic
1051174907 9:14351118-14351140 CCTGCTTAGCAGCTAGTCTGGGG - Intronic
1056710416 9:88988107-88988129 CCTGGTGAGCAGGTACAGTGTGG - Intergenic
1059505970 9:114800156-114800178 TCTGCTGAGCATCTATTCTATGG + Intronic
1062651386 9:137579470-137579492 CCTGCTGAGCCGCTTCTGGGGGG - Intergenic
1186591534 X:10935142-10935164 CCTGCTCAGCATCCATTGTTGGG + Intergenic
1187376317 X:18758310-18758332 CATGCTGAGCACCAACTGTGAGG - Intronic
1190524109 X:51311060-51311082 CCAGCACAGAAGCTATTGTGTGG + Intergenic
1196492229 X:116281238-116281260 TCTGTTGAGCAGCTATTGTGAGG - Intergenic