ID: 1020944540

View in Genome Browser
Species Human (GRCh38)
Location 7:14585862-14585884
Sequence TCTTACATGGGCGTGGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 8, 2: 62, 3: 192, 4: 393}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020944540 Original CRISPR TCTTACATGGGCGTGGTTCA TGG (reversed) Intronic
900867716 1:5280314-5280336 TGCTGCATGGCCGTGGTTCACGG - Intergenic
901949454 1:12730492-12730514 TCTTATATGGGTGTGGTTCGTGG + Intergenic
902165433 1:14567314-14567336 TCTTATATTGTTGTGGTTCATGG + Intergenic
903598033 1:24511568-24511590 TCTTATATGGGTGCAGTTCATGG + Intronic
903636112 1:24817969-24817991 TCTTATATGGGTGTGGTTTGTGG + Intronic
904580898 1:31543580-31543602 TCTTGTATGGGTGTGGTTTATGG + Intergenic
904777012 1:32915876-32915898 TCTGATATGTGCGTGGTTCATGG + Intergenic
905086213 1:35379884-35379906 TCTTACATTGACGTGGTTTGTGG + Intronic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
906269846 1:44468030-44468052 TCTTATATGAGTGTGGTTCATGG + Intronic
906558889 1:46739132-46739154 TCTTATATGGGTGTGGTTCCTGG + Intergenic
907610360 1:55863582-55863604 TCTTATATGGGCACAGTTCATGG - Intergenic
908008642 1:59752834-59752856 TCTTTCATGGCCGTGGTACAGGG + Intronic
908322462 1:62991605-62991627 TCTTACATGGTAGGGTTTCACGG + Intergenic
908340786 1:63176714-63176736 TCTTATATGGGTGCTGTTCATGG + Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909824165 1:80105130-80105152 TCTTACATGGGTGCAGTTTATGG + Intergenic
909916118 1:81321668-81321690 TCTTACATGGATGTGGCTCATGG + Intronic
910018667 1:82557808-82557830 TCTTATATGGGCATCGTTCTTGG - Intergenic
910231755 1:84995099-84995121 TCTTATATGGGCACAGTTCATGG + Intronic
910545735 1:88415331-88415353 TCTTACATGAGCACAGTTCATGG + Intergenic
910746309 1:90578849-90578871 TCTTTCATGGGCTTGATTCTTGG - Intergenic
910918322 1:92315305-92315327 TTTTATGTGGGCTTGGTTCATGG + Intronic
910983387 1:92980839-92980861 TCTTATATGGGTACGGTTCATGG - Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
911955758 1:104232895-104232917 ACTTATATGGGCATAGTTCATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
912731483 1:112110441-112110463 TCTTCTATGGGTGTGGTTCATGG + Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
913175197 1:116266952-116266974 TCTTACATGAGAGAGTTTCATGG + Intergenic
914776284 1:150738748-150738770 TCTTATATGCACGTGGCTCATGG - Intronic
915071381 1:153272107-153272129 TCTGAGATGGGCCTGGTGCATGG + Intergenic
915600005 1:156916387-156916409 TGTTATATGGGTGCGGTTCATGG - Exonic
916553147 1:165869127-165869149 TTTTATATGGGCGTGGTTGGTGG + Intronic
917353522 1:174102855-174102877 TCTTATATGAGCGTGGTTGGTGG - Intergenic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918632537 1:186735195-186735217 TCTTATATGGGAGTGGCTCATGG + Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
919033976 1:192282278-192282300 TCTTATATGAGTATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919113295 1:193247301-193247323 TCTTATATGGGTGTGGTTTGTGG - Intronic
919217251 1:194574643-194574665 TTTTATATGGGTGTGATTCATGG - Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
919548905 1:198959941-198959963 TCTTATATGGGTGTGGTTTATGG + Intergenic
920799197 1:209172038-209172060 TCTTACATGGGCACAGTTCATGG - Intergenic
921307968 1:213816093-213816115 TCTTACATGGGTGCAGTTCATGG + Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
923717821 1:236440769-236440791 TCTTATATGGGTGCAGTTCATGG - Intronic
923763147 1:236866341-236866363 TCTTCTATGGGTGTGGTTCATGG - Intronic
924006810 1:239621175-239621197 TTTTATATGGGAGTGGTTTATGG - Intronic
924435382 1:244035947-244035969 TATTACATGGGGGTGGGGCATGG - Intergenic
924499861 1:244627216-244627238 TCTTATATGGTCGCAGTTCATGG + Intronic
1062777233 10:162235-162257 TCTTACATAGGTGTGGTTTGTGG + Intronic
1062890238 10:1054020-1054042 TCTTATATAGGGGTGGTTCATGG + Intronic
1063598399 10:7458267-7458289 TTTAACATGGTCATGGTTCACGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1065410903 10:25426639-25426661 TCTTACATGGGTGAGGTTCATGG + Intronic
1065413699 10:25460975-25460997 TCTTATGTGGGTGCGGTTCATGG - Intronic
1068700396 10:60013764-60013786 TCTTACATAAGAGTGGTTCATGG + Intergenic
1068952979 10:62795921-62795943 TCATACATTGGCATGGTTCGGGG + Intergenic
1070315426 10:75306836-75306858 TCTTACAAGGGCGTGGTTCACGG - Intergenic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071054006 10:81487713-81487735 TCTAATATGGTCATGGTTCATGG - Intergenic
1071663014 10:87524819-87524841 TCTTATATGGGTGGGGTTCATGG + Intronic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074210692 10:111331458-111331480 TCTTATATGGGTGTAGTTCATGG - Intergenic
1075751302 10:124773673-124773695 TCTTACGTGGGCACAGTTCATGG + Intronic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1076808202 10:132870159-132870181 TCTCATATGGGCGTGGCTGATGG - Intronic
1076856891 10:133121085-133121107 TCTTATACGGGCGTGGTTTGTGG + Intronic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080842342 11:35996368-35996390 TCTTATATGGGTGTGGTTTGAGG + Intronic
1081212083 11:40348061-40348083 TGTTATATGGGCATGGATCACGG + Intronic
1082861865 11:57864379-57864401 TATTACATTGGCATGGTTCTGGG - Intergenic
1083487869 11:62994959-62994981 TCTGACGTGGGCATGGTCCAGGG + Intronic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1086494948 11:87393293-87393315 TCTTATATGAGCCTGGTTCATGG - Intergenic
1086896977 11:92324532-92324554 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1087577510 11:100008085-100008107 TCTTCTATGGGCATAGTTCATGG + Intronic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1089625995 11:119751447-119751469 TCTAACTTGGGGGTGGTTCTTGG + Intergenic
1090147777 11:124345016-124345038 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093252536 12:16825071-16825093 TCTTACATGGGCACAGATCATGG - Intergenic
1093435161 12:19128450-19128472 TCTTACATGGGCTCAGTTCATGG + Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1093691166 12:22110818-22110840 TCTTACATGGGCACATTTCATGG + Intronic
1094280122 12:28727643-28727665 TCTTACATGGGAGCTGTTCATGG + Intergenic
1095466960 12:42497584-42497606 TCTTATATGGGCACAGTTCATGG + Intronic
1097206509 12:57326064-57326086 TCTTACATGGGCACAGTTCCTGG - Intronic
1097453281 12:59763858-59763880 TCTTATATGGGCACAGTTCATGG - Intronic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1098575803 12:72040842-72040864 TCTTATATAGGTGTGATTCATGG + Intronic
1098752084 12:74306434-74306456 TCTTATATGGGTTTGGTTTATGG + Intergenic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100117506 12:91325252-91325274 TTTTATATGAGTGTGGTTCATGG + Intergenic
1100618720 12:96251240-96251262 TCTTATACAGGTGTGGTTCATGG - Intronic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1101872347 12:108576467-108576489 TCTTACATGGGCACAGTTCGTGG + Intergenic
1104395713 12:128430786-128430808 TCTTATATGGGCACAGTTCATGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1105780048 13:23697639-23697661 TCTTATATGGGGTTAGTTCATGG - Intergenic
1106149325 13:27083145-27083167 TCTTAAATGGGTGCAGTTCATGG + Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107068731 13:36245992-36246014 TTTTATATGGGCTTGGTTTATGG - Intronic
1109080499 13:57893725-57893747 TCTTATATGGGCACAGTTCATGG - Intergenic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109254706 13:60065019-60065041 TCTAACATGGGTGTGGTTTGTGG + Intronic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110300792 13:73924480-73924502 TCTTCTATGGGCAGGGTTCATGG - Intronic
1110382517 13:74870106-74870128 CGTTACATGGGTGTGGTTTATGG + Intergenic
1110766480 13:79285069-79285091 CCTTACATGGGTGTGGTTTGTGG - Intergenic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111839941 13:93437102-93437124 TTTTATATGGGCATGATTCATGG - Intronic
1112521143 13:100096344-100096366 ACTTATATGGGCGTGGTTCACGG - Intronic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1113057153 13:106281200-106281222 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1113487040 13:110661876-110661898 TCTTCCATGGATGTGGTTCATGG + Intronic
1113535878 13:111065976-111065998 TTATACATGGGCATGGTTCAGGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1115019000 14:28651973-28651995 TCTTTTATGGGTGTGGTTTATGG - Intergenic
1115379156 14:32714168-32714190 TCTTATATGGGTGTGGTTTGTGG + Intronic
1115627936 14:35213752-35213774 TCTTACGTGAGTGTGGTTCATGG + Intronic
1115627986 14:35214583-35214605 TCTTACATGGGTGTGGTTCCTGG + Intronic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1116476203 14:45342686-45342708 TCTTATATTGGAGTGGTTCTTGG + Intergenic
1116607184 14:47015157-47015179 TCTTTTATGGGTGTGGTTCATGG + Intronic
1117263433 14:54060798-54060820 TATTACATGGGTGTGGCTCATGG + Intergenic
1117588195 14:57235960-57235982 TATTACAGGGGCTGGGTTCACGG - Intronic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1117932304 14:60855853-60855875 TCTTATATGGGTGTGGTTCCTGG - Intronic
1118693009 14:68358098-68358120 TCTTACAGAGGTGTGGTTGATGG + Intronic
1119145151 14:72305598-72305620 TCTTATACAGGTGTGGTTCATGG - Intronic
1120081825 14:80226104-80226126 TCTCACATGGCCGAGATTCATGG - Intronic
1121018751 14:90565903-90565925 TCTTATATGGGTGTGGTTCATGG + Intronic
1121165568 14:91793649-91793671 TCTTATATAGGTGTGGTTCGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1123013829 14:105364000-105364022 TCTTACATGGGTGATGTTCGTGG + Intronic
1123138960 14:106056458-106056480 TCTTACCTGGAGTTGGTTCAGGG - Intergenic
1124639254 15:31385629-31385651 TCTTATATGGAAGTGGTTCATGG - Intronic
1124901580 15:33828167-33828189 TCTTACAAGGGCATAGTTCATGG - Intronic
1125236764 15:37523756-37523778 TCTTAGATGAGTGTGGTTCGTGG + Intergenic
1125870618 15:43098228-43098250 TCTTTTATGGATGTGGTTCATGG + Intronic
1125979427 15:43987006-43987028 TCTTCTATGTGTGTGGTTCATGG - Intronic
1127081438 15:55384255-55384277 TCTTTCATAGGCACGGTTCATGG + Intronic
1127495983 15:59512646-59512668 TCTTACCTGGCAGGGGTTCACGG + Intronic
1127592773 15:60443529-60443551 TCTCACATGCACGTAGTTCAAGG - Intronic
1128690170 15:69718459-69718481 TCTTACATGGGTGCAGTTCATGG + Intergenic
1129289822 15:74556345-74556367 TCTTATATGGGTGTGATTCTAGG + Intronic
1129499290 15:76020106-76020128 TCTTACACAGTCATGGTTCATGG - Intronic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1131169738 15:90169090-90169112 TCTTGTATGGGCCCGGTTCATGG + Intronic
1131404433 15:92152787-92152809 ACTTACCTGGGGATGGTTCATGG - Intronic
1131756578 15:95570138-95570160 TCTTACATGGGAGCAGTTCTTGG + Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1134208927 16:12259823-12259845 ACTTTGATGAGCGTGGTTCAGGG + Intronic
1137234136 16:46599473-46599495 TCTTTTATGGATGTGGTTCATGG + Intronic
1137740374 16:50765350-50765372 TCTTATATGGGTGTGGTTTGTGG - Intronic
1138836012 16:60435516-60435538 TCTTATATGGGCATGTTTCCTGG - Intergenic
1139014005 16:62668027-62668049 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1140574681 16:76152798-76152820 TCTTATATGGGCATAGTACATGG + Intergenic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1142908774 17:3069205-3069227 TCTTATGTGGGTGTGGTCCATGG + Intergenic
1142919024 17:3168257-3168279 TCTTACATGGGTGCAGTTCGTGG + Intergenic
1142925792 17:3235040-3235062 TCTTATGTGGGTGTGGTCCATGG - Intergenic
1142953035 17:3499663-3499685 TCTCACATGGGCACGATTCATGG - Exonic
1143005673 17:3831737-3831759 TCTGTCAAGGGGGTGGTTCATGG + Intronic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1146042985 17:29474624-29474646 TCTTATATGGGCACAGTTCATGG + Intronic
1146158361 17:30543783-30543805 TCTTAGATGGGCACAGTTCATGG - Intergenic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1149177182 17:53886717-53886739 TTTTATATGGGCCTGGTTCATGG + Intergenic
1149299404 17:55290511-55290533 TCTTATATGGGTGTGGCTCATGG - Intronic
1150090023 17:62315543-62315565 TCTTACATGGTTGCTGTTCATGG - Intergenic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1154392490 18:13952026-13952048 TCTTAGATGGGAGTGGGTCGTGG - Intergenic
1155511888 18:26586326-26586348 TCTTATATGGGTGCAGTTCATGG - Intronic
1155561790 18:27086211-27086233 TGTTACATGGGTGTGTGTCATGG - Intronic
1156128310 18:33935493-33935515 TCTTAATTTGGCATGGTTCACGG + Intronic
1156181784 18:34613184-34613206 TCTTATATGAGTGTAGTTCATGG - Intronic
1156684108 18:39623455-39623477 TTATACATTGGCGTGGTTCTGGG - Intergenic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1157687236 18:49652148-49652170 TCTTGCATAGGCCTGGCTCATGG + Intergenic
1158212076 18:55062764-55062786 TCTTATACAGGCCTGGTTCATGG + Intergenic
1159332133 18:67009447-67009469 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159656856 18:71040210-71040232 TCTTATATGTGGGTAGTTCATGG - Intergenic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1159700536 18:71621162-71621184 TGTTACATGGGTGTGGTTTGTGG + Intergenic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160166218 18:76514765-76514787 TCCTATATGGGCGTGGTTTGTGG + Intergenic
1160552051 18:79700024-79700046 TCTTATGTGGGTGTGGTTCGTGG - Intronic
1165359176 19:35324174-35324196 TTTTACATGGGTGTGTTTTATGG - Intronic
1165686532 19:37826071-37826093 TCTTACATGGGTGCAGCTCACGG - Intergenic
1166580183 19:43890268-43890290 TCTTATATGGGTGTGGCTCACGG + Intronic
1167626824 19:50595833-50595855 TCTGATATGGATGTGGTTCATGG - Intergenic
1168337441 19:55604643-55604665 TCTGAGGTGGGCGTGGTTCAGGG + Intergenic
1168337581 19:55605298-55605320 TGTGAGATGGGCGTGGTTCAGGG + Intergenic
925200478 2:1964237-1964259 TCTTACACGGGCGCGGTTCCTGG + Intronic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
926057467 2:9782764-9782786 TCTTATATGGGCACGATTCATGG - Intergenic
926608438 2:14921263-14921285 TCTTATATGAGTGTGGTTCATGG + Intergenic
927322550 2:21764284-21764306 TCTTATATGGATGTGGTTCATGG + Intergenic
928332750 2:30370083-30370105 TCCTACAAGGACGGGGTTCAGGG - Intergenic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
931327213 2:61239053-61239075 TCTTATATGGGTGTAGTTCGTGG - Intronic
931407941 2:61998913-61998935 TCTTCTATGGGCATGTTTCATGG + Intronic
931924857 2:67060971-67060993 TCTTATATGAGTGTGGTTCATGG + Intergenic
931960957 2:67482364-67482386 TCTTATATGAGCATTGTTCATGG - Intergenic
932116756 2:69057530-69057552 TCTTACATGTGTGTGGTTTGTGG - Intronic
932286453 2:70537173-70537195 TCTTCTACGGGTGTGGTTCATGG - Intronic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
932951033 2:76293821-76293843 TCTTACACGGGCATGATTCTTGG + Intergenic
933182049 2:79238304-79238326 TCTTACATGGCTGTGATTCATGG + Intronic
933626734 2:84609587-84609609 TCTTATATAAGCATGGTTCATGG + Intronic
933896809 2:86818576-86818598 TCATAAATGGGCATGGTTCATGG - Intronic
934058968 2:88276370-88276392 TCTCAAGTGGGCATGGTTCATGG - Intergenic
935796917 2:106651498-106651520 TCTTATATGGCTGTGGTTCACGG + Intergenic
936005298 2:108881800-108881822 TCTTACATGGGTGTGGTTCTTGG + Intronic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
937174027 2:119908491-119908513 TCTTATATGGGTGTGGTTTGTGG - Intronic
938423884 2:131167987-131168009 TCTTATATGGGTGTGGTTTGTGG - Intronic
939285462 2:140123386-140123408 TCATATATGGGTGTGGTTCATGG + Intergenic
939653376 2:144791473-144791495 TCTTACATTGGTGTGGTTCATGG + Intergenic
940608429 2:155958692-155958714 TCTTATATGGATGTGGTTCATGG - Intergenic
940756653 2:157690574-157690596 CCTTAGATGGGCATGGTTCATGG + Intergenic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
941727638 2:168880864-168880886 TCTTATATGGGTGTCATTCATGG + Intronic
941733020 2:168939947-168939969 TCTTATATTGGCGTGGTTCGTGG - Intronic
942747780 2:179255023-179255045 TCTTATATGGGTTTGATTCATGG - Intronic
942833193 2:180261533-180261555 TCTTATATGGGTGTGGTTCTTGG + Intergenic
943247004 2:185467459-185467481 TCTTAAAGGGGCATAGTTCATGG + Intergenic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944273949 2:197814388-197814410 TATTATATGGGCATAGTTCATGG - Intronic
944529565 2:200653914-200653936 TCTTATATGGATGTGGTTCATGG - Intronic
944623034 2:201538629-201538651 TCTTAGATGGGTGTGGTTTGTGG - Intronic
944719990 2:202414258-202414280 TTTTATATGGGTGTGGTTCCTGG - Intronic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
945346116 2:208718777-208718799 TCTTATATGGGCACAGTTCATGG + Intronic
946086333 2:217176952-217176974 TCCTATATGGGTATGGTTCATGG + Intergenic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947234603 2:227926943-227926965 TTTTATATGGGCATGATTCATGG - Intergenic
947554022 2:231073172-231073194 TTTTATATGGGTGTGGTTCGTGG + Intronic
947555423 2:231088597-231088619 TTTTACATGGGTGTGGTTCGTGG - Intronic
947786297 2:232824034-232824056 CCTTACATGGGCACAGTTCACGG - Intronic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169313922 20:4572177-4572199 TCTTACTTGGGATTGGTTCAAGG - Intergenic
1170247075 20:14233103-14233125 TCTTATATGGGTGTGGTTCATGG + Intronic
1170605319 20:17871272-17871294 ACTTACATGTGTGTGGTTCTTGG - Intergenic
1170642695 20:18169513-18169535 TCTCATATGGGTGTGGTTCATGG - Intronic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1171313163 20:24162417-24162439 TCTCACATGGGTGTGGTTTGTGG - Intergenic
1172131909 20:32661584-32661606 TCTTCCTTGGGCCTGGTTCTGGG + Intergenic
1172236360 20:33378347-33378369 TCTTATGTGGGTGTGGCTCATGG + Intronic
1173910714 20:46667964-46667986 TCTTATATGGGCACAGTTCATGG - Intronic
1174650527 20:52121023-52121045 TCTTACATGGGCACAGTTCATGG - Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1174980820 20:55392600-55392622 TCTTACATAGTCGGGGTTTAAGG - Intergenic
1175173651 20:57096508-57096530 TGTGACATGGGCATGGGTCATGG - Intergenic
1176311345 21:5152176-5152198 TCTTACATGGGCACGGATCACGG + Intronic
1176702523 21:10072678-10072700 TCTTATATGGATGTGGTTCATGG + Intergenic
1177044030 21:16146931-16146953 TCTTACATGCAGGAGGTTCATGG - Intergenic
1177167627 21:17620404-17620426 TCTTGTATGGGTGTGGTTCATGG + Intergenic
1178100546 21:29264129-29264151 TCTTATATGGGCGGGGTTTGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1178519443 21:33275871-33275893 TCTTATATAGGTGTGGTTCATGG + Intronic
1179772038 21:43627970-43627992 TCTTACATGGGTGTGGCTCATGG - Intronic
1179845705 21:44109859-44109881 TCTTACATGGGCACGGATCACGG - Intronic
1180113274 21:45676577-45676599 TCTTATATGGGCAAAGTTCATGG - Intronic
1180848870 22:19000846-19000868 TCTTATATGGGCACAGTTCATGG + Intergenic
1180887760 22:19259615-19259637 TCTTATATGTGTGTGGTTCATGG - Intronic
1180932590 22:19603296-19603318 TCTTATACGGGCATGGTTCCGGG + Intergenic
1181664064 22:24378758-24378780 TCTTATATGGGCACAGTTCATGG + Intronic
1182734596 22:32523199-32523221 TCTTATATGGGTGTGGTTCATGG - Intronic
1182977265 22:34635132-34635154 TCTTTCCTGTGCGTGCTTCATGG + Intergenic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1183267992 22:36841697-36841719 TCTTACATAGTCATGGCTCATGG - Intergenic
1184575247 22:45358840-45358862 TCTTATATGGGAGTGGTTCATGG + Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
949306565 3:2648526-2648548 TCTTATATGGGTGCGGTTCATGG - Intronic
949391726 3:3569827-3569849 TCTTATGTGAGCGTGATTCATGG - Intergenic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949984663 3:9531106-9531128 TCTTACATGGGCGCAGTTCATGG + Intronic
950632407 3:14291514-14291536 TCTTACATGGGCACAGTTCATGG - Intergenic
950780364 3:15386528-15386550 TTATACATGGGCATGGTTCCAGG + Intronic
950976364 3:17249856-17249878 TCTTATATGGGTGCAGTTCATGG + Intronic
951333039 3:21388168-21388190 TCTTACATGGGCACAGTTAATGG - Intergenic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
951507002 3:23458315-23458337 TCTTCTATGGGTGTGGTTCATGG + Intronic
952084219 3:29798095-29798117 TCTTAAATGGGTGCTGTTCATGG + Intronic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
953211881 3:40883107-40883129 TATTCTATGGGTGTGGTTCATGG + Intergenic
953367211 3:42355323-42355345 TCTTCTATGGGTGTGGTTCATGG - Intergenic
953837903 3:46363100-46363122 TCTTACATGGGTGCACTTCATGG - Intergenic
954373220 3:50180667-50180689 TTTTATATGGGTGAGGTTCACGG + Intronic
954944591 3:54409319-54409341 TTTTATATGGGTGTGGTTCATGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955448415 3:59038702-59038724 TCTTATATGGGGTTTGTTCATGG - Intronic
956960612 3:74395973-74395995 TCTTACATGAGCAGGGTTCATGG - Intronic
957260268 3:77893030-77893052 TCTTACATGGGTGCAATTCATGG - Intergenic
957782914 3:84842777-84842799 TCTTACATGGGTGTGGTTTGTGG - Intergenic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
958971953 3:100621049-100621071 CTTTACATGGACGTGGTTCACGG - Intronic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959681460 3:109101268-109101290 TCTCACATGGGCCTGGTTAAGGG - Intronic
959721704 3:109498103-109498125 TCTCATATGGGCCTGGTTCATGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960179853 3:114562867-114562889 TCTTATATGGGTGTGGTTTGTGG + Intronic
960258873 3:115542114-115542136 TCTTATATGGGCGCTGTTCATGG + Intergenic
960476386 3:118134543-118134565 TCTTACATGGGTGAGGTTTGTGG - Intergenic
960794040 3:121465702-121465724 TCTTACATGAGTGTGGTTCATGG - Intronic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
963054018 3:141169165-141169187 TCTTATATGGGTGTGGTTCATGG - Intergenic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963183845 3:142391003-142391025 TCTCAAATGGGCATGGTTGATGG + Intronic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963746719 3:149131523-149131545 TCTCACATGGGCACAGTTCATGG - Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964535007 3:157711186-157711208 TCTTACATGGATGTAGTTCATGG - Intergenic
964617009 3:158677156-158677178 TCTTATATGGGCAGGTTTCATGG - Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964823288 3:160797287-160797309 TCTTCTATGGGTGTGATTCATGG - Intronic
964942165 3:162171972-162171994 CCTTATATGGGCCTGATTCATGG - Intergenic
965352254 3:167628064-167628086 TCTTGTATGGGTGTGGTTCATGG - Intronic
965918630 3:173883360-173883382 TCTTATATGGGTGTGGTTTGTGG + Intronic
965996034 3:174884244-174884266 TCTTTCATGGCCAGGGTTCATGG - Intronic
965998771 3:174920979-174921001 TCTCACATGGTCATGGTCCATGG + Intronic
966116288 3:176467230-176467252 TCTTGTATGGGTGTGGTCCATGG - Intergenic
966214336 3:177486490-177486512 TCTTATATGGGCACAGTTCATGG + Intergenic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967545273 3:190718373-190718395 TCTTATATGGGTGTGGTTCATGG + Intergenic
967571699 3:191036860-191036882 TCTTATATGAGCATGGTTCTTGG - Intergenic
967994236 3:195154657-195154679 TTGTACATTGGCGTGGTTCTGGG - Intronic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970629793 4:17927720-17927742 TCTCATATGGGAGTGGTTCGTGG + Intronic
970884638 4:20973862-20973884 TCTTACATGGATGTAGTTCATGG + Intronic
971044091 4:22785434-22785456 TATTATATGTGCTTGGTTCATGG + Intergenic
971086080 4:23276702-23276724 TCTTACAAGGGCACAGTTCATGG - Intergenic
972189358 4:36571240-36571262 TCTTACATGGGTGTGGTTCGTGG + Intergenic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
973658388 4:53075734-53075756 TCTTACATGGGGGTAGTTCATGG + Intronic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974448702 4:62021777-62021799 TCTTATATGGGTGAGGTTCATGG - Intronic
974667346 4:64981550-64981572 TCCTAAATGGGTGTGGTTCATGG - Intergenic
974997018 4:69174152-69174174 TCTTATATGGGCGTGGATTGTGG - Intronic
975008033 4:69314634-69314656 TCTTATATGGGCGTGGATTGTGG + Intronic
975009989 4:69339115-69339137 TCTTATATGGGCGTGGATTATGG - Intronic
975124923 4:70771038-70771060 TCTTATATGGGCGTAGTTCATGG + Intronic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
975478282 4:74847931-74847953 TCTTATATAGGCATGATTCATGG - Intergenic
975900383 4:79144738-79144760 TCTTACATGGGTGCAGTTCATGG + Intergenic
975916411 4:79330992-79331014 TTATACATTGGCATGGTTCAGGG - Intergenic
976154457 4:82127602-82127624 TCTTATATGGGCTAGGTTCCTGG - Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977069744 4:92370224-92370246 TCTTACATGGGTGAAATTCATGG - Intronic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977103999 4:92857050-92857072 TATCATATGGGCGTGGTTAATGG - Intronic
977314338 4:95426274-95426296 TCTTATATGAGTGTGGTTCATGG - Intronic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977715132 4:100173612-100173634 TCTCATATGGGTGTGGTTCGTGG + Intergenic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978249424 4:106612240-106612262 TCTTATATGGGAGTGGTTTGTGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979648626 4:123104289-123104311 TCTTACATGGGTGTGGTTTATGG - Intronic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979811560 4:125042608-125042630 TCTTACAAGGGCATGGTTCGTGG - Intergenic
979846252 4:125516295-125516317 TCTTATTTGGGTGTGGTGCATGG + Intergenic
980374697 4:131929097-131929119 TCTTATATAGATGTGGTTCATGG + Intergenic
980529465 4:134033225-134033247 TCTTATATGGGTGTGGTTTGTGG - Intergenic
980759990 4:137220274-137220296 TCTTATATGGGTGCAGTTCATGG - Intergenic
981439359 4:144765533-144765555 TCCTACACAGGCATGGTTCATGG + Intergenic
981464422 4:145051307-145051329 TATTATATGAGCATGGTTCATGG + Intronic
981493002 4:145361112-145361134 TCTTACATGGGTGTGGTTTGTGG - Intergenic
981984784 4:150840575-150840597 TCTTAAATGGGTGTGGTTTGTGG + Intronic
982085122 4:151827347-151827369 TCTTACATGAGCATGTTTCATGG + Intergenic
982148217 4:152421866-152421888 TCTTCTATGGGTGTGGTTCATGG + Intronic
983058260 4:163125048-163125070 TATTATATGGGCATAGTTCATGG - Intronic
983275917 4:165617277-165617299 TCTTATATGGGTGTGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
983652889 4:170051231-170051253 TCTTACAGGGGCACAGTTCATGG + Intergenic
983764421 4:171459958-171459980 TCTTATATGGACCTGGTTAATGG + Intergenic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984479115 4:180276302-180276324 TTTTACATGGTTCTGGTTCATGG - Intergenic
984637143 4:182123601-182123623 TCTTATATAGGCATGGCTCATGG + Intergenic
985185613 4:187311948-187311970 TCTTACATGGGTGCAGTTCATGG + Intergenic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
986059369 5:4173611-4173633 TCTGACATCAGCGTGGCTCAAGG + Intergenic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987726654 5:21709324-21709346 TCTTATATGGGCACAGTTCATGG - Intergenic
987966324 5:24880584-24880606 TCTTATATGGGAGTGGTTTGTGG - Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988889109 5:35595267-35595289 TCTTATATGGGTGTGGTTTGCGG + Intergenic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
989762047 5:45027569-45027591 TCTTACGTGGGCATGCTTCATGG - Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990979388 5:61588145-61588167 TCTTATATGGGCAGGTTTCATGG - Intergenic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
991183459 5:63781245-63781267 TCTTACTTGACCCTGGTTCAGGG - Intergenic
992922219 5:81537718-81537740 TCTTGTATGGGTGTGGTTCACGG - Intronic
994628730 5:102254473-102254495 TCTTAAAGGGGCATGGTTCATGG - Intronic
994900741 5:105765406-105765428 TCTTATATGGTCGCGGTTCATGG + Intergenic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995214400 5:109578580-109578602 TCTTATATGGATGTGGTTCATGG + Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995670094 5:114593426-114593448 TCTTATATGGGTGTGCTTCATGG + Intergenic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
996072828 5:119154021-119154043 TCCTACATAGGCGCAGTTCATGG - Intronic
996482941 5:123996129-123996151 TTTTATATGGTCGTGGTACATGG + Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996586612 5:125095380-125095402 TCTTATATGGGTGTGGTTTGTGG - Intergenic
996847609 5:127917677-127917699 TCTTATATGGGTGCAGTTCATGG + Intergenic
998863646 5:146472493-146472515 TCTTACATGGGTGTGGTTTGTGG - Intronic
999497310 5:152112060-152112082 TCTTATATGAGTGTGGTTCTTGG + Intergenic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1001091338 5:168743448-168743470 TCTTTGATGGGCATGGTTCGTGG - Intronic
1003387935 6:5686039-5686061 TCTTTCTTGGGCGTGCTTCTGGG - Intronic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003706081 6:8531939-8531961 TCTTATATGGGCACAGTTCATGG - Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1004371593 6:15057344-15057366 TCTTATATGGGCGTAGTTCATGG + Intergenic
1004658157 6:17684903-17684925 TCTTATATGGGTGTGGCTCGTGG + Intronic
1004978605 6:20996580-20996602 TCTTATATGGGCGCGGTTTGTGG + Intronic
1005402245 6:25446961-25446983 TCTTATATGGGTGTGATTCATGG + Intronic
1005703317 6:28426485-28426507 TCTTATATGGGTGTGGTTAGCGG + Intergenic
1006407215 6:33852252-33852274 TCCCACATGGGCGTGGTTAGGGG - Intergenic
1007884227 6:45207735-45207757 TTTTATATGGGCCTGGTTCTTGG - Intronic
1008152267 6:47968288-47968310 TCTTACATGGGTGTGGTTTGTGG + Intronic
1008268921 6:49466199-49466221 TCTGATATTGGCATGGTTCATGG + Intronic
1008299105 6:49812391-49812413 TCTTATATGGGTGTGGTCCATGG + Intergenic
1008622500 6:53284879-53284901 TCTTATATAGGTGTGGTTCATGG - Intronic
1009346286 6:62615718-62615740 TTTTACATTGGCTTGGTTCCAGG + Intergenic
1009525700 6:64742280-64742302 TCTTATATGGGTGTGGCTTATGG + Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010064796 6:71669742-71669764 TCTTATATGTGCATGGGTCATGG - Intergenic
1010303346 6:74287069-74287091 TTTTACAAGGGCGTGGGTCATGG + Intergenic
1010693143 6:78934182-78934204 TCTTATATGGGTGTGGTTTGTGG + Intronic
1011069829 6:83368139-83368161 TCTTATATGGGAGCGGTTCATGG + Intronic
1011872075 6:91907923-91907945 CCTTAAATGGGTGTGGTTCATGG + Intergenic
1012287685 6:97412895-97412917 TCTTACATGGGTGCACTTCATGG + Intergenic
1013088826 6:106880546-106880568 TCTTACATGAGTGTGGTTTGTGG + Intergenic
1013172627 6:107650603-107650625 TCTTACATGGGTGCAGTTCATGG - Intronic
1013381868 6:109581058-109581080 TCTTATATAGATGTGGTTCATGG - Intronic
1013414684 6:109914035-109914057 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013811881 6:114054053-114054075 TGTTTCATGGGCGTGCTTCCTGG - Intergenic
1014294211 6:119598483-119598505 TCTAATATGGGTGTGGTTCATGG + Intergenic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1015144837 6:129973944-129973966 TCTTATACAGGGGTGGTTCATGG - Intergenic
1015821812 6:137269287-137269309 TCTTATATGAACGTGGTTCATGG + Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1017068820 6:150554045-150554067 TCTTATATGGGTGCAGTTCATGG - Intergenic
1017298289 6:152825653-152825675 TCTTACGTGGGCACAGTTCATGG + Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017385026 6:153873424-153873446 TCTTACGTGGGGGTGATTCATGG + Intergenic
1017734663 6:157350405-157350427 TCTTATATGGGTGTGATTCCTGG - Intergenic
1018271470 6:162082869-162082891 TCTCATATGGGTGTGGTTCATGG + Intronic
1018843753 6:167539535-167539557 TCTTACATGGGTGTGGCTCATGG + Intergenic
1018881414 6:167885562-167885584 TCTTATATGGGTGCAGTTCATGG + Intronic
1019159495 6:170059606-170059628 TCTTACATGGATGTGGTTTGTGG - Intergenic
1020090773 7:5339160-5339182 TCTTATATGGGCACTGTTCACGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020523276 7:9222690-9222712 TCTTATATGGGCGTGATTCATGG - Intergenic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021267980 7:18548234-18548256 TCTTATATGGGTGTGGTTCGTGG + Intronic
1021282765 7:18740454-18740476 TCTTGATTGGGTGTGGTTCATGG - Intronic
1021285379 7:18775132-18775154 TCTTATATGGGCACGATTCATGG + Intronic
1021829867 7:24594666-24594688 TCTTATATGGGGGTGATTCATGG + Intronic
1021974794 7:26001211-26001233 TCTTATATGGGTGCAGTTCATGG + Intergenic
1022061955 7:26806056-26806078 TCCTATATGGGTGTGGCTCATGG - Intronic
1022197193 7:28080745-28080767 TCTTATATGGGTGCAGTTCATGG + Intronic
1022365748 7:29714312-29714334 TCTTACTTGGGAATGGCTCAGGG - Intergenic
1022548899 7:31217730-31217752 TTTTATATGGGTGTGGTTCATGG + Intergenic
1023026067 7:36050878-36050900 TCTTATATGGGTGCGGTTCATGG - Intergenic
1023099988 7:36707330-36707352 TCTTATATGGGTGTGGTTCATGG + Intronic
1024257952 7:47552614-47552636 TCTTATATGGATTTGGTTCATGG - Intronic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026330565 7:69348597-69348619 TCTTATATGGGAGTGGTTCATGG + Intergenic
1026482770 7:70792960-70792982 TCTTACACGGGCTGGGTTCGAGG - Exonic
1027526413 7:79274909-79274931 TATCATATGGGCATGGTTCATGG - Intronic
1027556322 7:79669095-79669117 TCTTTCATGGCTCTGGTTCAAGG + Intergenic
1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG + Intronic
1027945011 7:84733413-84733435 TCTTATATTGGCGTGGTCCATGG + Intergenic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030483686 7:110138346-110138368 TCTTAAGTGTGCATGGTTCATGG - Intergenic
1030567714 7:111180446-111180468 TCTTACATGGGTGAGGTTTGTGG + Intronic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1031954760 7:127931038-127931060 TCTTATATGACTGTGGTTCATGG - Intronic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032701597 7:134385099-134385121 TCTTACATGGGCACAGTCCATGG - Intergenic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1033107574 7:138542430-138542452 TCTTACATGGGTGTGGTTTGTGG + Intronic
1033112509 7:138593776-138593798 TCTTACATGAGTGTGGTTAGTGG + Intergenic
1033140865 7:138825211-138825233 TGTTCTATGGGCATGGTTCATGG - Intronic
1033388417 7:140902289-140902311 CCTTATATGGGTGTGGTTCGTGG - Intronic
1033393845 7:140955384-140955406 TCTTATATGGGCGCAGTTCATGG - Intergenic
1033534058 7:142295993-142296015 TCTGACATGGGCGATGATCAGGG - Intergenic
1034210800 7:149360356-149360378 TCTTATATGGGTTTGGTTCATGG - Intergenic
1034404446 7:150892910-150892932 TCTTACACGGGCATGGCTCACGG - Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1035387075 7:158480311-158480333 TCTTCTATGGGCACGGTTCATGG - Intronic
1037263365 8:17032955-17032977 TCTTATATGGGTGCGGTTCATGG - Intronic
1037327835 8:17711967-17711989 TCTTAGATGAGCATGGTCCATGG + Intronic
1037519158 8:19662890-19662912 TGTTTCATGGGAGTGGTTGAAGG - Intronic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1040754030 8:50748780-50748802 TCTTATATGGGCACAGTTCATGG - Intronic
1040774128 8:51018470-51018492 TCTTATATGGGCGTGGTGTGTGG + Intergenic
1042140417 8:65673298-65673320 TCTTACATGTGCTTGGTTCATGG + Intronic
1042396438 8:68296412-68296434 TTTTACATTGGCATGGTTCCAGG - Intergenic
1042409843 8:68451653-68451675 TCTTACATGGGTGTGGTTTGTGG + Intronic
1042441028 8:68826853-68826875 TCTTATATGAGTGTGGTCCATGG + Intergenic
1042547998 8:69967980-69968002 TCTTACACGGGGGTGGTTTATGG - Intergenic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1044461189 8:92446356-92446378 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1044889521 8:96818299-96818321 TCTTACATGGGTGTAGTTCGTGG + Intronic
1045232952 8:100322873-100322895 TCTTCAGTGGGAGTGGTTCATGG + Intronic
1047034520 8:120922475-120922497 TTTTATATGGGAGTGGTTCATGG + Intergenic
1048054342 8:130849103-130849125 TATTAGAGGGGCGTGGGTCATGG + Intronic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1049227429 8:141463079-141463101 TCTTATATGAGTGTGGCTCATGG - Intergenic
1049629138 8:143642769-143642791 TCTTATATGGGTGCGGTTCATGG + Intronic
1050321433 9:4456846-4456868 TTGTATATGGGCATGGTTCATGG + Intergenic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1050792575 9:9492930-9492952 TCTTATATGGGTTGGGTTCATGG - Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051123744 9:13780308-13780330 TCTTATATGGGCAACGTTCATGG - Intergenic
1051254125 9:15194786-15194808 TCTTATATGGGTGTGGTTCAGGG - Intronic
1051601702 9:18881520-18881542 TTTTATATGAGCATGGTTCATGG + Intronic
1051613588 9:18985197-18985219 TCTTATACGGGCGTGGCTCATGG + Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051753568 9:20370318-20370340 TCTTACATGGGTGCGGTTTGTGG - Intronic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1051770764 9:20576626-20576648 TCTTATATGGGCACGCTTCATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052060474 9:23954450-23954472 TACTACATGGGAATGGTTCATGG - Intergenic
1052111336 9:24586809-24586831 TCTTACATGGGCACGGTTACTGG + Intergenic
1053172494 9:35899460-35899482 TATTATATGGGCGCAGTTCATGG + Intergenic
1053639724 9:40059395-40059417 TCTTATATGGATGTGGTTCATGG + Intergenic
1053766409 9:41406040-41406062 TCATATATGGATGTGGTTCATGG - Intergenic
1054320473 9:63655734-63655756 TCTTATATGGATGTGGTTCATGG + Intergenic
1054545026 9:66317220-66317242 TCTTATATGGATGTGGTTCATGG - Intergenic
1054795903 9:69301549-69301571 TCTTGTATAGGTGTGGTTCATGG + Intergenic
1055039533 9:71854369-71854391 TCTTATATGAGCGTGTTTCATGG + Intergenic
1055377230 9:75662309-75662331 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1055807406 9:80111957-80111979 TCTTATCTGGGTGAGGTTCATGG + Intergenic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056658347 9:88526908-88526930 TCTGACATCAGCGTGGTGCAGGG - Intergenic
1056979237 9:91293040-91293062 TCCTATGTGGGCGTGGTTCATGG - Intronic
1057287378 9:93768958-93768980 GCTCACATGGATGTGGTTCATGG + Intergenic
1057538977 9:95946878-95946900 TTTTATAGGGGCATGGTTCATGG - Intronic
1058196361 9:101981725-101981747 TCTTATATGGGCACAGTTCATGG - Intergenic
1058641723 9:107093593-107093615 TCTTACATGGGTGTGGTTTATGG + Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059558892 9:115311722-115311744 TCTTATATGAGCTTGATTCATGG - Intronic
1059844279 9:118255183-118255205 TCTTATATGGGTGTGGTTCATGG - Intergenic
1059951815 9:119472129-119472151 TCTTACATATGTGTGGTTTAAGG - Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1202787542 9_KI270719v1_random:42770-42792 TCTTATATGGATGTGGTTCATGG + Intergenic
1185733373 X:2478804-2478826 TCTTACATGGTGGTGGTCCCCGG - Intronic
1186199350 X:7140960-7140982 ACTTATATGGGTGCGGTTCATGG - Intronic
1186321927 X:8437090-8437112 TTTTACAATGGCATGGTTCAGGG + Intergenic
1186942350 X:14523766-14523788 TCCTATACGGGTGTGGTTCATGG + Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1186969877 X:14830173-14830195 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187760115 X:22573864-22573886 TCTTATATGGGTGCAGTTCATGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1188093026 X:25987113-25987135 TCTTATATGGGAGTGGTTCATGG - Intergenic
1188221912 X:27551028-27551050 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1188456154 X:30368715-30368737 TCTTATATGGGTGAAGTTCATGG + Intergenic
1189060166 X:37745207-37745229 TCTTATATGGGTGTGGTTTGTGG + Intronic
1189072429 X:37877929-37877951 TTTTATATGAGCATGGTTCATGG - Intronic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1190715729 X:53101647-53101669 TCTTACATGGGTACAGTTCATGG + Intergenic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1193055918 X:77150301-77150323 TCTTATATGGGTGTGGTTCTTGG + Intergenic
1193331524 X:80240187-80240209 TCTTATAAGAGTGTGGTTCATGG - Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193652203 X:84150641-84150663 TCTTATGTGTGCGTGGTTCATGG + Intronic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1193906000 X:87244898-87244920 TCTTATTTGGGGGTGGTTTAGGG - Intergenic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1195338729 X:103883445-103883467 TCTTATATGGGCACAGTTCATGG - Intergenic
1195593332 X:106657761-106657783 TCTCACATGGGTGTGGTTTGTGG + Intronic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196564041 X:117183726-117183748 TCTTACATAGGCATGGTTGGTGG - Intergenic
1196578043 X:117343969-117343991 TCTTATCTGGGTGTGGTTCGTGG + Intergenic
1197114047 X:122810968-122810990 TCTTATAAGGGCATGGTCCATGG - Intergenic
1197444172 X:126528183-126528205 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1197473708 X:126894291-126894313 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198281424 X:135146601-135146623 TCTGATATGGGTGTGGTTCTTGG + Intergenic
1198289535 X:135225915-135225937 TCTGATATGGGTGTGGTTCTTGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198999700 X:142620220-142620242 TCTTATATGGGTGTGGTTTATGG + Intergenic
1199343756 X:146714126-146714148 TCGTATATGGGCATGTTTCAGGG - Intergenic
1199359239 X:146898342-146898364 TCTTACATAGGCGTGGTTTGTGG - Intergenic
1199971030 X:152861342-152861364 TCTTACATGGGCCTGTTCCCAGG + Intronic
1200514126 Y:4120666-4120688 TTTTATATGGGTGTGGTTCATGG + Intergenic