ID: 1020946382

View in Genome Browser
Species Human (GRCh38)
Location 7:14613608-14613630
Sequence AAAACCTCCTCCACAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020946382 Original CRISPR AAAACCTCCTCCACAAAGAA AGG Intronic