ID: 1020946382

View in Genome Browser
Species Human (GRCh38)
Location 7:14613608-14613630
Sequence AAAACCTCCTCCACAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020946382 Original CRISPR AAAACCTCCTCCACAAAGAA AGG Intronic
902424596 1:16309865-16309887 AAAACCTACTCTACTAAAAAAGG + Intronic
903032473 1:20473680-20473702 AAGACCTCCTCCCGAAAGCAAGG + Intergenic
904394469 1:30209370-30209392 AAATTCTCCCCCACAAAGAACGG - Intergenic
904639043 1:31908397-31908419 CAACCCTCCCCCACAAAAAAAGG + Exonic
908994809 1:70138741-70138763 ACGAGCTCCTCCACACAGAAAGG - Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909857170 1:80550349-80550371 AAAACTTCCTCAACCAAGTAAGG + Intergenic
911370550 1:96989662-96989684 CACACCCCCTCCACAGAGAAGGG + Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
912266376 1:108161411-108161433 AAAACCCCATCCACAAATATAGG + Intronic
912412195 1:109487135-109487157 AAAACCTCCTCCAGGGAGAAGGG + Exonic
913650302 1:120907202-120907224 AAAACCTCCTCCACAAATATTGG + Intergenic
914170816 1:145221872-145221894 AAAACCTCCTCCACAAATATTGG - Intergenic
914525931 1:148465831-148465853 AAAACCTCCTCCACAAATATTGG - Intergenic
914640471 1:149601285-149601307 AAAACCTCCTCCAAAAATATTGG + Intergenic
916215097 1:162387197-162387219 AAGCCCTCTTCCACCAAGAAAGG + Intergenic
916608756 1:166369121-166369143 AAAACCTCTCCCCCAAAGAGGGG + Intergenic
917107368 1:171506204-171506226 AAAACATCTTCCAAAAATAAAGG - Intronic
917215227 1:172671294-172671316 GAACCCTCCTCCACAAAGAATGG - Intergenic
917396865 1:174603077-174603099 AAAATCTTCTCCAAAAAGACAGG - Intronic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919307047 1:195855660-195855682 CTAACTCCCTCCACAAAGAAAGG + Intergenic
920144985 1:203852262-203852284 AAATCATCCTCCACAGAGAGTGG - Exonic
920166804 1:204041781-204041803 AAAACCTCCCTGAAAAAGAACGG + Intergenic
920594723 1:207257649-207257671 AACACTTCATCCAGAAAGAAAGG - Intergenic
921746462 1:218745837-218745859 AAAATCACCTTCACAAAAAAAGG + Intergenic
921820323 1:219609742-219609764 AAATCATCCTCCACAGAGAGTGG + Intergenic
921973624 1:221177590-221177612 AAACCCTCCTCCCTAAAGCATGG - Intergenic
922287420 1:224182582-224182604 ACAACCTCTTCCTGAAAGAAAGG - Intronic
922338980 1:224640447-224640469 CCAACCTCCTCTGCAAAGAAAGG - Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
922917244 1:229268995-229269017 CAAACCTCCCCCAAAGAGAAGGG + Intergenic
923092028 1:230748018-230748040 AAAACCTTATCCACAAGGACAGG + Intronic
923631710 1:235653413-235653435 AAAAAATCCTCCAAAAACAAAGG - Intergenic
923826796 1:237509212-237509234 AACACCTCCTGCACCAGGAAAGG - Intronic
924181471 1:241442850-241442872 AAAACCACAACCACAAAGGAAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063920815 10:10931104-10931126 AAAACCTAATCCGAAAAGAAAGG - Intergenic
1064272432 10:13877759-13877781 AAAACCTCCCCCAGGAAGAATGG - Intronic
1064563055 10:16611404-16611426 AAAAATTCCTCAACAAAGAATGG - Intronic
1064742569 10:18448694-18448716 ACAACCTCCACCCCAGAGAAGGG + Intronic
1066030842 10:31422043-31422065 AAAACCCCGTCCAGAAAGGATGG - Intronic
1066698752 10:38104061-38104083 AAAAGCTCCTGCATAAAGCAGGG - Intronic
1066974269 10:42351030-42351052 AAAACCTTCTGCACAGAAAAGGG + Intergenic
1068144243 10:53045786-53045808 AAAACATCATCTGCAAAGAAGGG + Intergenic
1068358415 10:55942643-55942665 AAAAAATCCCCCACAAAGATTGG - Intergenic
1068742185 10:60486028-60486050 AAAACTTCCCTCAAAAAGAATGG + Intronic
1068992495 10:63164262-63164284 AAAACCTCCCCAGCCAAGAAAGG + Intergenic
1069403242 10:68071838-68071860 AAGACCTTAACCACAAAGAAAGG + Intronic
1072508036 10:96089936-96089958 AAAACTTGGTACACAAAGAAGGG + Intergenic
1073773814 10:106764362-106764384 AAGTGCTCCTCCACAAAGAAGGG + Intronic
1075625071 10:123958130-123958152 AAAATCTTCTCCACAAATATTGG - Intergenic
1076802922 10:132840342-132840364 AACACCTGCTCAAGAAAGAAAGG - Intronic
1076928309 10:133507225-133507247 CAAACCTCTTCCAGAAAGAATGG - Intergenic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080804832 11:35642989-35643011 GAAAACTCCTCAACAAAGAAAGG - Intergenic
1082153987 11:48779988-48780010 AAAAACTACTCAAAAAAGAAAGG + Intergenic
1082215782 11:49567038-49567060 GAAACCCCCTCAACAAAAAAAGG - Intergenic
1083619006 11:64039794-64039816 CAAACAACCTCCACAAAGCAAGG - Intronic
1083747077 11:64742635-64742657 AAAGCCTCCTCCGCAACGCAGGG - Intronic
1084791106 11:71475645-71475667 CAAACTTCCTCCACAGAGAAGGG + Intronic
1085718094 11:78890509-78890531 AAAACCCCCTTTAAAAAGAAGGG - Intronic
1086633800 11:89057435-89057457 GAAACCCCCTCAACAAAAAAAGG + Intronic
1088138706 11:106590011-106590033 TAAACCTCCTTGACAAAAAATGG + Intergenic
1088942773 11:114477523-114477545 ACAACACCCTCCACAAAAAAAGG + Intergenic
1089134737 11:116240009-116240031 AAAACCTCGACCAAAAAGGAAGG + Intergenic
1090709372 11:129372322-129372344 AAAACCTACTTCACAAGGATGGG - Intergenic
1092734818 12:11570981-11571003 AAAAAATATTCCACAAAGAAAGG - Intergenic
1092878886 12:12872477-12872499 AAAAACTCCTTCAAAGAGAATGG - Intergenic
1094618348 12:32056629-32056651 AAAATTTCCCCCACAAAGGATGG - Intergenic
1094693322 12:32791694-32791716 AAAATCTTTTCCACAGAGAAAGG - Exonic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1094818210 12:34206201-34206223 AAGACCTCCTCCAGAATGCATGG + Intergenic
1096601242 12:52731279-52731301 ACAACCCCCTGTACAAAGAACGG + Intergenic
1096803185 12:54125265-54125287 AAAACCTCATCCACACACAGAGG + Intergenic
1097656873 12:62375901-62375923 AAAAGCTGATCCACAAGGAAAGG - Intronic
1100691212 12:97040286-97040308 AATCCCTCCTCCACAATGAATGG + Intergenic
1100978629 12:100146986-100147008 AAATTTTCCCCCACAAAGAATGG - Intergenic
1101617625 12:106353602-106353624 AAGATCACATCCACAAAGAAAGG + Intergenic
1102564448 12:113786261-113786283 ATAACCTCTTCAGCAAAGAATGG - Intergenic
1102570630 12:113825073-113825095 ACAACATCCCACACAAAGAAAGG - Intronic
1102987494 12:117290389-117290411 AAACAGTCCCCCACAAAGAATGG - Exonic
1103767757 12:123293846-123293868 AAACCCTCCTGCAGTAAGAATGG - Exonic
1104393847 12:128414947-128414969 ACAACCTTCTCCACAGAAAAGGG - Exonic
1105229882 13:18482806-18482828 AAAACCTTCTGCACAGAAAAGGG + Intergenic
1105639169 13:22244473-22244495 AAAACCACCTCAACCCAGAAAGG - Intergenic
1107179296 13:37439828-37439850 AAAATCTCCTCTACAACAAAGGG - Intergenic
1107655626 13:42589899-42589921 AAAACCGACTACACAAAGAAGGG - Intronic
1107843141 13:44480975-44480997 AAAACCTACTATAAAAAGAAGGG + Intronic
1107859932 13:44651038-44651060 AAAACCACCTGCACAAATTAAGG + Intergenic
1108895088 13:55316333-55316355 ACAACCACCTCCACCATGAATGG - Intergenic
1110414760 13:75240151-75240173 TAAAACTTCTCCACAAAAAAAGG + Intergenic
1112779708 13:102886044-102886066 AAAACTTCCTCAATAAATAAAGG + Intergenic
1113218190 13:108068185-108068207 AGATTTTCCTCCACAAAGAATGG - Intergenic
1113349718 13:109517146-109517168 AAAACCTCCTACACAAAGGCAGG - Intergenic
1113364806 13:109666103-109666125 AAAACCTCCTGAGCAAAGCAAGG - Intergenic
1114014131 14:18409634-18409656 AAAACCTTCTGCACAGAAAAGGG + Intergenic
1114350738 14:21848153-21848175 AAAATATCTTCCACAAATAAAGG - Intergenic
1117406613 14:55410530-55410552 CAAACCTCCTCAAAAGAGAAAGG + Intronic
1117893418 14:60450972-60450994 AAAGCCTCCTCAAGAAAGACAGG + Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1120384055 14:83821399-83821421 AAAACCACTTCTACAAAAAAAGG + Intergenic
1121955935 14:98212992-98213014 AATGCCTTCTCCAAAAAGAAAGG + Intergenic
1122062359 14:99144478-99144500 AAATCTTCCCCCACAAAAAATGG - Intergenic
1122231490 14:100308225-100308247 CAAACCTCCTCAACCAGGAATGG - Intergenic
1122667140 14:103338451-103338473 TAATCCTCCTCCACATACAATGG + Exonic
1124392718 15:29274150-29274172 AACACATCCTCCACAGACAAGGG + Intronic
1129986141 15:79921470-79921492 AAAGCCTCCTCCTCAAAGTTTGG + Intronic
1131071249 15:89467538-89467560 AAACCCTCCCCCATAAAGCATGG + Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1132023384 15:98383973-98383995 AAAACCTACTCAACAATTAAAGG - Intergenic
1133067865 16:3222164-3222186 AAATCCTCCACAACAGAGAAAGG - Intergenic
1134001999 16:10790206-10790228 AAATTTTCCCCCACAAAGAATGG + Intronic
1134908500 16:18002875-18002897 GAAACCTCCTCCACAGTGTACGG - Intergenic
1135810691 16:25584147-25584169 AAAAGCTCCTCAACAAAGACAGG - Intergenic
1136049199 16:27638575-27638597 AAAAGCTGCTCCACCAAGAGAGG + Intronic
1138038869 16:53640035-53640057 AAAAAGTCCACCACAGAGAATGG + Intronic
1138418670 16:56885704-56885726 TAAACCTCCTCTACAAAGAGGGG - Intronic
1140581985 16:76241360-76241382 AAATCCTCCTTCACAAAGATAGG - Intergenic
1148209605 17:45800289-45800311 AAAAACTCCTTCCCAAAGCAAGG + Intronic
1148703975 17:49611580-49611602 GAAACCACCTCCACAAATCAAGG + Intronic
1152315566 17:79578443-79578465 ACAGCCACCTCCCCAAAGAACGG - Intergenic
1152379018 17:79932737-79932759 AAAACCCCCTCAACAAAGAGGGG - Exonic
1154122635 18:11664149-11664171 AAATCATCATCCACAAAGTAAGG - Intergenic
1154950864 18:21208506-21208528 AAAAACTCTTCCAGAAAGTAGGG - Intergenic
1155865932 18:30964778-30964800 TAATCCTCCTCCACAAGGTATGG + Intergenic
1157027996 18:43869851-43869873 AAAACCAACTCAACAAAGCAAGG + Intergenic
1157494490 18:48145513-48145535 AAAGTCTCCTCCACAAATATTGG + Intronic
1158157874 18:54445787-54445809 ACAACCTACTCCACAGGGAAGGG - Intergenic
1158564341 18:58541917-58541939 GAAATCTCCTCCTAAAAGAAAGG - Intronic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160020246 18:75174708-75174730 AAAAGCCCCTCCCCAAGGAAGGG + Intergenic
1163588697 19:18178068-18178090 GAATCCTGCTCCACTAAGAATGG + Exonic
1163943172 19:20513567-20513589 AAGACTTCTTCCACACAGAAGGG - Intergenic
1164085762 19:21900891-21900913 AAAATCTCCTTCAGAAAGAAGGG - Intergenic
1168391525 19:56012103-56012125 AAATCCACCCCCACAAGGAAAGG + Intronic
925385769 2:3460662-3460684 AAAACACCCTCCACGAAGATAGG - Intronic
925808534 2:7675708-7675730 AAAACCTCCTCTGCCAACAAAGG - Intergenic
927443010 2:23132894-23132916 ATATCCTCCCCCACAAAAAATGG + Intergenic
928624822 2:33128840-33128862 AACACATCCTCCAAGAAGAAAGG - Intronic
928990029 2:37223437-37223459 AAAACCATCTCCACAACCAATGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
930120841 2:47759443-47759465 ATAACATCTTCAACAAAGAATGG + Intronic
930211752 2:48646355-48646377 AAAATCTCATCCACAAAGGCTGG - Intronic
930333386 2:50015338-50015360 AAAACTTCCACATCAAAGAAAGG - Intronic
931191665 2:60007151-60007173 GACACGTCCTCCACAAAGTAGGG - Intergenic
931808327 2:65829634-65829656 AAAACTTCCTCTTCAAACAAAGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
934064233 2:88325284-88325306 AAAATATCCTTCACAAATAAAGG + Intergenic
935263978 2:101379106-101379128 ATTATCTCCTCCAAAAAGAAGGG + Intronic
937002564 2:118481511-118481533 CATAGCTCCTCCACAAACAATGG + Intergenic
937845308 2:126572996-126573018 AAAAATTCCAGCACAAAGAAGGG + Intergenic
938171075 2:129077248-129077270 AAGACCTCCTACAGAAAGTAGGG + Intergenic
938234260 2:129690315-129690337 AAGAGCTCCTCAGCAAAGAATGG + Intergenic
938522829 2:132089912-132089934 AAAACCTTCTGCACAGAAAAGGG - Intergenic
938663117 2:133507227-133507249 AACAGCTCCTCCTCACAGAAAGG + Intronic
938994487 2:136663398-136663420 AAAATGTCCTCCCCAAATAAAGG + Intergenic
940866322 2:158820902-158820924 AGAACCTCCACCAACAAGAAAGG + Intronic
941380440 2:164785896-164785918 AAATCCTCCTCCGCAACAAAAGG + Intronic
941615647 2:167715876-167715898 TAAAACTTCTCCACAAAAAAAGG + Intergenic
943018875 2:182548642-182548664 AAAATTTCACCCACAAAGAATGG - Intergenic
943704760 2:191022721-191022743 TAAAAGTCCTCCACAAAGAATGG - Intergenic
943786657 2:191885020-191885042 AAAACTGCCTACACTAAGAAAGG + Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
945408212 2:209476944-209476966 AAAACCTTCATCACAAAGATTGG + Intronic
945566890 2:211412305-211412327 AAACCCCCCACCACAAACAAAGG - Intronic
947664136 2:231892635-231892657 CCAACCTCCTCCACGAAAAAGGG + Intergenic
947692852 2:232155374-232155396 AGAAATTCCTCCACAAAGACTGG - Intronic
1168943720 20:1734306-1734328 AAAACCTCACCAAAAAAGAAAGG - Intergenic
1169633495 20:7661074-7661096 ATAATCTCCTCTACAAAAAAAGG + Intergenic
1169959625 20:11144724-11144746 CAAACCTGCTCCACGAAGACAGG - Intergenic
1170819460 20:19744059-19744081 AAAACCTTATCCAGGAAGAAAGG - Intergenic
1171323856 20:24273353-24273375 AATACCTCCCCCACCAAAAATGG - Intergenic
1174847466 20:53956774-53956796 AAATACACCTCCACAAAAAATGG - Intronic
1178713465 21:34941680-34941702 AAAATCACCTTCAAAAAGAATGG - Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1180282040 22:10709223-10709245 AAAACCTACTCAAGAAGGAAAGG + Intergenic
1180353684 22:11822922-11822944 AAAAACTGCACCACAGAGAAGGG - Intergenic
1180438628 22:15340440-15340462 AAAACCTTCTGCACAGAAAAGGG + Intergenic
1180521488 22:16210875-16210897 AAAACCTTCTGCACAGAAAAGGG + Intergenic
1180904500 22:19399262-19399284 TAAACCTCTTGTACAAAGAAAGG - Intronic
1181548442 22:23619654-23619676 AAAGCCTCTTCCACAAATGATGG + Intronic
1184833810 22:47008512-47008534 AAATCAGCCTCCACAAAGACTGG - Intronic
1185242476 22:49754138-49754160 TCAGCCTCCTCCACAAAGCAGGG + Intergenic
1203239283 22_KI270732v1_random:40381-40403 AAAACCTACTCAAGAAGGAAAGG + Intergenic
950340898 3:12243443-12243465 AGAAACACCTCCACAATGAAAGG - Intergenic
950559879 3:13715225-13715247 AAAACAGCCTCCACACACAAGGG - Intergenic
950958626 3:17081113-17081135 ACCACCTGCTCCACAAAGAGGGG - Intronic
951448524 3:22810597-22810619 GAAACATCCTCCACAGACAATGG - Intergenic
953887946 3:46728432-46728454 AAAACCTACACCAGAAAAAAAGG + Intronic
955148577 3:56344541-56344563 AAAACATCATCCTCTAAGAAAGG + Intronic
955392406 3:58531126-58531148 ATAACCTCCTCCCCCAAGAGAGG - Intronic
955444826 3:58998607-58998629 ATATCCTCCTCCACAAAGATAGG - Intronic
956296635 3:67722115-67722137 AAAATGTCCTCCATAAATAAAGG - Intergenic
956667450 3:71655433-71655455 AAAAGCCCCTTCAAAAAGAAGGG + Intergenic
956733526 3:72218081-72218103 AAAATCAACTCCACAGAGAATGG + Intergenic
958234639 3:90966036-90966058 AAAACCGCCTATCCAAAGAAAGG - Intergenic
958722846 3:97866839-97866861 AAAGTCTCCTCAACAAATAATGG + Intronic
959208142 3:103339950-103339972 AAAACCTCCTGGACAAATCAGGG - Intergenic
959589171 3:108057836-108057858 AAAAGCTCTTCCACAAATACAGG + Intronic
960509199 3:118527659-118527681 AAAACCTCCTTGACATACAAGGG + Intergenic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964336104 3:155655764-155655786 AAAATCTCTTCCAAAAAGAAAGG + Intronic
964884474 3:161465186-161465208 GTCACCTCCTCCACAAAGAAGGG - Intergenic
965602279 3:170467248-170467270 AAACCCTCCTCCACTGAGAAGGG + Exonic
968315885 3:197725029-197725051 AAATCCCTCCCCACAAAGAAAGG + Intronic
968819538 4:2839562-2839584 AAAACCCCCCCCAAAAAAAAAGG - Exonic
969631072 4:8337067-8337089 AAAACCTCCTCTTCCATGAAGGG + Intergenic
971808077 4:31386757-31386779 TAAACCTCCTCCACAAAGAGAGG + Intergenic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975756954 4:77580669-77580691 AAACCATCCTCCAGAAATAAAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
976271624 4:83236286-83236308 AAAACTCTCCCCACAAAGAAAGG + Intergenic
976684661 4:87798728-87798750 GAAACCAACACCACAAAGAATGG - Intergenic
976793476 4:88906378-88906400 AAAACCACCTCCAAAAACCAAGG - Exonic
976893709 4:90082324-90082346 AAAATCTCCTCCAAGAAGCATGG - Intergenic
977020195 4:91748604-91748626 AAAAACTCCTCTAGAAAGAGGGG + Intergenic
977202273 4:94131073-94131095 AACATATCCTCCACGAAGAAGGG - Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978484480 4:109235563-109235585 CACAGCCCCTCCACAAAGAATGG + Intronic
978883505 4:113738356-113738378 AATCCATCCTCCACAAATAATGG + Intronic
979300364 4:119080003-119080025 AAATCCTTCTCCACAAATATTGG - Intergenic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
980255485 4:130375781-130375803 AAAGGCTCCTCCACAAATATTGG - Intergenic
981054154 4:140342792-140342814 AATACTTCCTCCTCAAACAAAGG + Intronic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983256024 4:165401680-165401702 AAACCCTCCTCCACTCAGGAAGG - Intronic
983743690 4:171167736-171167758 AAGACCTCCTCCAGAAATACTGG + Intergenic
986224415 5:5799844-5799866 AAAACCACCTCCACAGTGAAAGG - Intergenic
986526457 5:8683773-8683795 AAAACCTCCTCCACCCCCAATGG + Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988272124 5:29031096-29031118 AAACCCTGGTCCCCAAAGAAGGG + Intergenic
988324806 5:29749824-29749846 AAAACCACAGCTACAAAGAAGGG - Intergenic
988673787 5:33410113-33410135 AAAACTTCCAGCCCAAAGAAAGG - Intergenic
989236023 5:39149563-39149585 AACAACTCCTTTACAAAGAAAGG - Intronic
989750407 5:44885970-44885992 AAAACCACATCCACAAAGATTGG - Intergenic
989981405 5:50649745-50649767 AAAACCTCCTCCACAAATATTGG + Intergenic
990826020 5:59898825-59898847 AAAACCTGCTCCACTCAGAAGGG - Intronic
991061850 5:62384445-62384467 TAACACTCCTCAACAAAGAAAGG - Intronic
994001407 5:94785144-94785166 AAAAACTCTTCCATTAAGAAAGG + Intronic
994371922 5:98977317-98977339 AAAACATTCTCCACACAAAATGG + Intergenic
994522828 5:100863091-100863113 AAATCCTCCTCCCCAAAGGTAGG + Intronic
995338000 5:111024633-111024655 AAAATATTCTCCACAAAGAGTGG + Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996085670 5:119302481-119302503 AAAACATCCTTCCCAAAGACAGG - Intronic
997278073 5:132615117-132615139 AAAATTTCCTGCAGAAAGAAGGG - Intronic
997491647 5:134282353-134282375 AAAACCTACTCCTCAAAAAGAGG - Intergenic
998297899 5:140989214-140989236 AAAACTTCAGCTACAAAGAATGG - Intronic
1000024567 5:157347558-157347580 AAAGCATCCTCCCCACAGAAAGG + Intronic
1002788373 6:420885-420907 ACAGCCTGTTCCACAAAGAAAGG + Intergenic
1004291443 6:14371019-14371041 ATATCCTCTTCCCCAAAGAAAGG + Intergenic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1005360906 6:25029895-25029917 ATAACATCCTGCACACAGAAGGG - Intronic
1006110034 6:31738895-31738917 AAAATCCCCTCCAGCAAGAAAGG - Intronic
1006979535 6:38135890-38135912 AATACCTGCTCCACAGAGAAGGG - Intronic
1009565314 6:65304820-65304842 AAATCATCCTCCACAGAGAGTGG - Intronic
1009991715 6:70851421-70851443 AAAACCTTTTCAACAATGAATGG - Intronic
1010185106 6:73134813-73134835 AAAACCTCCGCCACCAACACGGG + Intronic
1010439901 6:75881487-75881509 AAAAGCTCCTGAAGAAAGAAAGG + Intronic
1011239138 6:85252353-85252375 AAACCCACCTCCCCAAAGATGGG + Intergenic
1011638289 6:89395897-89395919 AAAGCCACCTCCAAGAAGAAAGG + Intronic
1011673887 6:89712326-89712348 AAAACCTCTTTCACAAATATTGG + Intronic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013918854 6:115375581-115375603 AAAACCACCTCAAAAAAGTAGGG + Intergenic
1013978664 6:116104279-116104301 AAAATCTCCTCCACAAGGTAAGG + Intronic
1015306148 6:131710828-131710850 TAAAACTTCTCCACAAAAAAAGG + Exonic
1015442170 6:133261269-133261291 AAAACCCCCAAAACAAAGAATGG - Intronic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017790580 6:157794918-157794940 CAAACTTCCTCCACCAAAAAAGG + Intronic
1017862678 6:158413594-158413616 ACAACCTGCTCAACAAGGAAAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1018882833 6:167902470-167902492 AACACATCCCCCACAAATAAGGG - Intronic
1019340156 7:505146-505168 AAAACCTCCTCCATAAAAGAAGG + Intronic
1020741726 7:12028410-12028432 TAAACCTCCTTTAAAAAGAAGGG - Intergenic
1020946382 7:14613608-14613630 AAAACCTCCTCCACAAAGAAAGG + Intronic
1020982633 7:15090454-15090476 AAAACATGCTTTACAAAGAATGG + Intergenic
1021920524 7:25480626-25480648 AAAACTTCCTCTACAAAAAGAGG - Intergenic
1022122410 7:27322067-27322089 AAACCCTCCTTCAGAAGGAAAGG + Intergenic
1023497873 7:40817068-40817090 AAAACCAACTCAACTAAGAATGG - Intronic
1023596946 7:41839724-41839746 AACACATCCTCCACAGATAAGGG - Intergenic
1026388424 7:69875123-69875145 AAAAGCTCATCCAGGAAGAATGG - Intronic
1030064525 7:105649147-105649169 AAACACTGCTCCACAAAGAAAGG - Intronic
1030696802 7:112593901-112593923 AAAACCTACTGTACAAAAAAGGG - Intergenic
1031551766 7:123123147-123123169 AAACCCTCCACCAACAAGAATGG + Exonic
1031683669 7:124706199-124706221 AAAAGGCCCTCAACAAAGAAAGG - Intergenic
1032400808 7:131623128-131623150 AGAACCTTCTCCAGAAAGACTGG - Intergenic
1032840672 7:135711111-135711133 AAAGCCGCCTCCACAAAGCCTGG - Intronic
1032993377 7:137418759-137418781 AAAAACTGCTAAACAAAGAATGG + Intronic
1033168928 7:139066353-139066375 AAAACGTCCTGCACAGAGAAAGG + Intronic
1033678834 7:143571985-143572007 TAAAACTTCTCCACAAAAAAAGG - Exonic
1033693004 7:143757469-143757491 TAAAACTTCTCCACAAAAAAAGG + Exonic
1033731401 7:144183671-144183693 TAAAACTTCTCCACAAAAAAAGG - Exonic
1033740263 7:144269061-144269083 TAAAACTTCTCCACAAAAAAAGG + Exonic
1033857385 7:145580943-145580965 GAAAACTCATCCACAGAGAATGG - Intergenic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1038025167 8:23581724-23581746 AAAACTTCCTTTACACAGAATGG + Intergenic
1038097066 8:24325111-24325133 CTAAACTCCTCCACAAAGAATGG - Intronic
1039218422 8:35299500-35299522 AACACAACCTCCACAAAGCATGG - Intronic
1039459593 8:37732469-37732491 AGACCCTCCCCCACAAAAAAGGG + Intergenic
1040742970 8:50603644-50603666 AAAGCCTCCCCAAGAAAGAAAGG - Intronic
1040881740 8:52212546-52212568 TAAACTTCCTCCATATAGAAAGG + Intronic
1044016423 8:87052650-87052672 AAAACCTCCTCATCCAAGAAGGG - Intronic
1045555879 8:103213973-103213995 AAATCTGCCTCCACAAAGATAGG + Intronic
1045995054 8:108352528-108352550 AAAACCTTCTCAAGAAAGATGGG + Intronic
1049013414 8:139903306-139903328 AAATGCTCCTCCAGACAGAATGG + Intronic
1049908130 9:237992-238014 AAATCCTCCTCTACAGAGGAGGG - Intronic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050644746 9:7707221-7707243 AAAACCTGCTCTAGAAAGATTGG + Intergenic
1050754855 9:8990071-8990093 AATACCTTCTTCACAAATAATGG - Intronic
1052496918 9:29238892-29238914 AAAACCTGATCCAGGAAGAAAGG + Intergenic
1053119535 9:35536252-35536274 AAAACAACTTCCACAAAAAACGG - Intronic
1053701510 9:40697031-40697053 AAAACCTTCTGCACAGAAAAGGG - Intergenic
1054411576 9:64820487-64820509 AAAACCTTCTGCACAGAAAAGGG - Intergenic
1057125084 9:92610622-92610644 AAAGCCTCCTCCCAAAAGCAGGG - Intronic
1060667075 9:125438430-125438452 CAATCCTCCGCCCCAAAGAATGG + Exonic
1186374205 X:8980978-8981000 AAGCCAGCCTCCACAAAGAAAGG - Intergenic
1186678329 X:11844342-11844364 AAAAAATCCTCCAAAAATAAGGG - Intergenic
1187582889 X:20627670-20627692 AAAACATCCCCCAGAGAGAAAGG - Intergenic
1188029031 X:25243643-25243665 ATAGCTTCCTCCACAAAGGAGGG + Intergenic
1189074882 X:37905264-37905286 GCAGCCTCCTCCACAAGGAAGGG + Intronic
1191169437 X:57427250-57427272 AAAAACTTCCCAACAAAGAAAGG + Intronic
1192242829 X:69348387-69348409 AACACACCCTCCACAAAGAGTGG + Intergenic
1192327798 X:70148039-70148061 AAAAACTCACACACAAAGAAAGG - Intronic
1193009396 X:76659058-76659080 AAAACCTTCCCAAGAAAGAAAGG + Intergenic
1194529967 X:95035011-95035033 AAAACATCTAACACAAAGAAAGG - Intergenic
1194780303 X:98016586-98016608 AAAATATCCTCCAAAAATAAAGG - Intergenic
1194831234 X:98624727-98624749 AAAACCTCCCCAATAAATAAGGG + Intergenic
1195429462 X:104772155-104772177 AAAACCTCATCCTGAAAGAAAGG - Intronic
1195500825 X:105596985-105597007 AAAAGCTTCTGCACAAAAAAGGG + Intronic
1196192401 X:112808658-112808680 AATACCATCTCCACACAGAAAGG + Intronic
1198434920 X:136607843-136607865 AAATTTTCCCCCACAAAGAATGG + Intergenic
1200801478 Y:7391058-7391080 AAAATTTCCCCCACAAAGGATGG - Intergenic
1201733505 Y:17231608-17231630 AACACCACCTCCCCAAGGAAAGG - Intergenic
1201763271 Y:17560251-17560273 AAGACCTCCTCCAGAACGCACGG + Intergenic
1201838282 Y:18345739-18345761 AAGACCTCCTCCAGAACGCACGG - Intergenic