ID: 1020953575

View in Genome Browser
Species Human (GRCh38)
Location 7:14710570-14710592
Sequence GAAGTTTCTCTCATTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020953575_1020953577 10 Left 1020953575 7:14710570-14710592 CCAATATCAATGAGAGAAACTTC 0: 1
1: 0
2: 1
3: 13
4: 170
Right 1020953577 7:14710603-14710625 TCTTAAATATAAAGTTTGATGGG 0: 1
1: 0
2: 2
3: 65
4: 808
1020953575_1020953576 9 Left 1020953575 7:14710570-14710592 CCAATATCAATGAGAGAAACTTC 0: 1
1: 0
2: 1
3: 13
4: 170
Right 1020953576 7:14710602-14710624 CTCTTAAATATAAAGTTTGATGG 0: 1
1: 0
2: 1
3: 30
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020953575 Original CRISPR GAAGTTTCTCTCATTGATAT TGG (reversed) Intronic
903196180 1:21690105-21690127 GGACTTTCTCTCTTTTATATTGG - Intronic
905085349 1:35370155-35370177 GAATTTCTTCTCATTCATATTGG - Intronic
906557080 1:46722333-46722355 AAAGTTTCTGTCTGTGATATGGG + Intergenic
908652205 1:66346903-66346925 GAATTTTCTATCTTTGAAATGGG - Intronic
908956758 1:69639814-69639836 AAAGTTTCTATCCTTAATATTGG - Intronic
910124151 1:83821901-83821923 GAACTCTCTTTCATTGATAGTGG + Intergenic
914409595 1:147413584-147413606 GAATTTTCTCTTATTAATAAAGG + Intergenic
916336732 1:163679914-163679936 GAATATTCTCTCATGCATATTGG + Intergenic
916865504 1:168852731-168852753 GAAGTTTCTCAAATGTATATAGG + Intergenic
917249711 1:173044909-173044931 GAAGTTCCTGACATGGATATGGG + Intronic
921340692 1:214131232-214131254 GAAGTTTATTGCAATGATATAGG - Intergenic
921512442 1:216048894-216048916 GATGTTTCTCCCATTAAAATGGG + Intronic
922430869 1:225551565-225551587 GGAGCTTCTCTGATTGATATAGG - Intronic
1063003608 10:1947222-1947244 AATTTTTCTCTCATTGACATGGG - Intergenic
1064387908 10:14914213-14914235 GAATTTCTTCTCATTAATATTGG - Intronic
1067580009 10:47438715-47438737 GAATTTTCTGTCATTTAAATGGG + Intergenic
1074304616 10:112265201-112265223 GAAGTTTCCCTCGATAATATTGG - Intergenic
1077908137 11:6549765-6549787 GAAATTTGTCTCATTCATTTTGG + Intronic
1081071022 11:38608462-38608484 GAAGATTCTCTGAATGATTTTGG + Intergenic
1081137342 11:39454599-39454621 ACAGTTTCTCTTATTTATATAGG - Intergenic
1081561023 11:44216765-44216787 CAAGTTTCTCTCATAGCTCTCGG - Intronic
1088163117 11:106898224-106898246 GAACTTTCATTCATTGCTATTGG + Intronic
1092662098 12:10749476-10749498 GAAGTTTCTTTAAGTGATACAGG - Intergenic
1093093235 12:14944171-14944193 CAATTTTCTTTCATTAATATAGG - Intronic
1093205099 12:16239172-16239194 GAAATTTATCTGATTGAAATGGG - Intronic
1093799248 12:23352247-23352269 GAAGTCTCTCTGATTTATTTTGG - Intergenic
1097278913 12:57832350-57832372 GAATTTTTTCTCCTTGATAAAGG - Intronic
1097487076 12:60216325-60216347 GGAGTCTCTCACATTGATAATGG + Intergenic
1098679654 12:73336274-73336296 GAACTTCCTCTTATTAATATAGG - Intergenic
1099440159 12:82688539-82688561 GAATTTTCCCTAATGGATATAGG - Intronic
1100860656 12:98802647-98802669 GAAGCTTTTCTCCTTGAGATGGG + Intronic
1101394719 12:104336127-104336149 GAAGTCTCTCTCAGTGAGACAGG - Intronic
1103868234 12:124071121-124071143 GAAGTTTATCTCATTGTGTTTGG + Intronic
1104052702 12:125206812-125206834 CAAGTTTCTCACATTGATGAAGG - Intronic
1107735437 13:43394299-43394321 GAATTTTCACTCAATGAAATTGG - Intronic
1108898524 13:55366237-55366259 GCAGTCTCTCTCATTGAGCTGGG - Intergenic
1108999639 13:56781253-56781275 GAAAATTCTCTCTTTGATGTTGG - Intergenic
1109004933 13:56861456-56861478 GCAGTTTCTCTAATAGACATAGG - Intergenic
1110023823 13:70510231-70510253 GATGTTTGTCTCATTGGTGTGGG - Intergenic
1111159612 13:84377362-84377384 GAACTTTGTCTCATTGACACTGG + Intergenic
1111451824 13:88428828-88428850 GAAGTGGCTCTCAGTGAGATGGG - Intergenic
1111742867 13:92226648-92226670 GGAGTTTCACTCACTGATCTCGG + Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1115897038 14:38102243-38102265 GTAGTTCCTCTGATAGATATAGG + Intergenic
1116150496 14:41135123-41135145 GAAGTTTCTTTCATGTAGATGGG - Intergenic
1116737233 14:48707433-48707455 AAAGCTTCTATCATTGAAATGGG + Intergenic
1117843510 14:59886061-59886083 GAACTTTGTCTCTTTGAAATGGG + Intergenic
1119049560 14:71353484-71353506 GAATTTCCTCTCACTGAGATGGG + Intronic
1120669416 14:87347124-87347146 GAACTTTCTATCATGGCTATGGG - Intergenic
1120793261 14:88605251-88605273 GAAGTTTCTCTAATTTTTACAGG - Intronic
1122685325 14:103501837-103501859 GAAGCTTCTCTCATCAGTATTGG + Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123554523 15:21414585-21414607 TAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1126370090 15:47936710-47936732 TAAGTTTCTATCACTGATCTTGG + Intergenic
1127755204 15:62085430-62085452 GAAGTTGCTCTGATTGATGATGG + Intergenic
1129043946 15:72716376-72716398 TAAGTCTCTTTCCTTGATATTGG - Intronic
1129819711 15:78590686-78590708 GAAGTTACTTTCATTAATTTTGG + Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1133660987 16:7917325-7917347 GAAGTTACTCTCATTGTGATGGG + Intergenic
1134906084 16:17981027-17981049 GAAGTTTCTCACATTCAAAATGG + Intergenic
1136639129 16:31547019-31547041 AAAGATTCCCTCAGTGATATTGG + Intergenic
1136665532 16:31808606-31808628 AAAGATTCCCTCAGTGATATTGG - Intergenic
1141293258 16:82740793-82740815 GAATGTTCCCCCATTGATATTGG - Intronic
1149228423 17:54503168-54503190 GTAATTTCTCTGATGGATATTGG + Intergenic
1149812258 17:59687870-59687892 TAAGTTTGTTTCATTTATATTGG - Intronic
1151029479 17:70719602-70719624 GATGTTACTCTCAATGATTTAGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155327687 18:24681622-24681644 GAAGTTTGTCTTGTTGAAATTGG + Intergenic
1158733029 18:60046663-60046685 GAAATTTCTCTGATTGCTCTAGG + Intergenic
1160238147 18:77102005-77102027 GAAAGTTCCCTCCTTGATATAGG + Intronic
1162118560 19:8446828-8446850 GAAGTTTTTCTCATTTCTAAGGG - Intronic
1164956887 19:32393972-32393994 GAAGTTTCTTTCATTTCTTTTGG - Intergenic
1166958344 19:46481325-46481347 GAAGTTTCTCTCATTTGTTACGG + Exonic
1168318931 19:55497361-55497383 TAATTTTCTCTCATTATTATTGG - Intronic
927337814 2:21945709-21945731 GAAGTTTCACTAATTGAAGTAGG - Intergenic
929307757 2:40383882-40383904 GAAGGTTCACTCTTGGATATAGG - Intronic
932107627 2:68961036-68961058 TCAATTTCTTTCATTGATATAGG - Intergenic
932441319 2:71737323-71737345 GCAGTGTCTCTCAGTGATACTGG - Intergenic
933543363 2:83677171-83677193 TAAGTTTCTTTTATTGCTATTGG + Intergenic
938226441 2:129620296-129620318 GAATTTTCTCTCTTTTATAAGGG + Intergenic
938290919 2:130150062-130150084 GAGTTCTCTCTCATTTATATTGG + Intergenic
938465626 2:131522892-131522914 GAGTTCTCTCTCATTTATATTGG - Intergenic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
938610132 2:132938798-132938820 GAAATGCCTCTCACTGATATAGG + Intronic
938840303 2:135154887-135154909 GAAGTTTCTTTAATGGATAGAGG - Intronic
939409324 2:141803793-141803815 GAACTTTCTATCTTTGACATAGG - Intronic
939710593 2:145513725-145513747 CAAGTTTCTCTCTTTGACTTTGG - Intergenic
941941075 2:171038555-171038577 GAATTTTCTCTCATTTCCATTGG + Intronic
942002359 2:171661171-171661193 GCAGTTTTTCTCATGAATATAGG - Intergenic
944952896 2:204773047-204773069 GAATTTTGTGTAATTGATATGGG + Intronic
945011928 2:205473523-205473545 CACGTTTCACTCATTAATATGGG + Intronic
945435839 2:209816748-209816770 GAAATTTCTCCCATTTTTATTGG + Intronic
946173337 2:217908283-217908305 GAAGTTTCTCTTCTTGCTATGGG - Intronic
947283695 2:228485176-228485198 GTAGTTTATTTCTTTGATATCGG - Intergenic
1173057579 20:39630709-39630731 AAAGTTTCTCTCATTGATTCTGG - Intergenic
1175406302 20:58732686-58732708 GAAGTTTAGATCATTGATTTGGG - Intergenic
1175557212 20:59873904-59873926 GAAGTTTTTCTCATTGTTTTTGG + Exonic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1178635095 21:34295411-34295433 TAAGTTACTCACATTGGTATTGG + Intergenic
1179350200 21:40602489-40602511 TCAATTTCTTTCATTGATATAGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
952697558 3:36286642-36286664 GAAGTTTCACTTGTTGATATAGG + Intergenic
955921065 3:63955733-63955755 GTATTTTCTTTCAGTGATATTGG + Intronic
962169649 3:133087601-133087623 GAAGTTTCTGACATTAAGATTGG + Intronic
962673004 3:137727977-137727999 GAAGTTTCTTTAATTGTTTTTGG + Intergenic
964645687 3:158956585-158956607 GGAGTGTCTCTCATTTATGTTGG - Intergenic
965848810 3:172996406-172996428 AAAGTTTTGCTCATTGATTTTGG + Intronic
966125768 3:176574617-176574639 TCAGTTTCTATCCTTGATATGGG - Intergenic
966955547 3:184874401-184874423 CAAGTTTTTATCATTGATTTGGG + Intronic
969328738 4:6460543-6460565 AAATTTTCTCTTAATGATATGGG - Intronic
970136638 4:12932427-12932449 GAACTCTGTCCCATTGATATTGG + Intergenic
970277531 4:14417897-14417919 GAAGTATCTCTAATTGCCATTGG - Intergenic
971622895 4:28879094-28879116 GAAGTATCTCTCCTGGACATTGG - Intergenic
971928072 4:33040618-33040640 GAAGTTTCACTCAGAAATATAGG + Intergenic
973776796 4:54250184-54250206 AAACTTTTACTCATTGATATAGG - Intronic
977101809 4:92825674-92825696 GAGGTGGCTCTCATTTATATGGG - Intronic
977346847 4:95826843-95826865 GAAGTTGCTCTCAATGATTTTGG - Intergenic
978992876 4:115107943-115107965 GAAGTTTCTTTCCTTGAAACAGG - Intronic
979063968 4:116102846-116102868 CAAGATTCTCTTTTTGATATTGG - Intergenic
980610991 4:135163349-135163371 AAATTTTCTCCCATTGATAAAGG + Intergenic
982776986 4:159452309-159452331 GAAGTTGATCTCATAGATGTAGG + Intergenic
983762170 4:171424715-171424737 CAAGTTTTTCTCATTTATCTGGG + Intergenic
984495679 4:180494465-180494487 GAAGTCTTTCTTATAGATATAGG + Intergenic
987239557 5:15981181-15981203 GAATTATCTCTCTTTGCTATGGG - Intergenic
989104946 5:37853830-37853852 GCAGTTGCTCTCATTCTTATGGG + Intergenic
990045565 5:51426351-51426373 GACATTTATCTCATTGCTATAGG + Intergenic
990996322 5:61735638-61735660 GAACTTTCTCTCATGGAGATTGG + Intronic
991316898 5:65319274-65319296 GAAGTTTGAATCATTGATTTTGG - Intronic
991995575 5:72383175-72383197 GAAGTTACTCACATTGGTAGTGG + Intergenic
992007735 5:72495050-72495072 GAAGTTTCCCTCATTGATGTTGG + Intronic
994405145 5:99335605-99335627 AAATTTACTCTCATTGAGATGGG - Intergenic
995086813 5:108120480-108120502 TAAATTTTTCTCAATGATATAGG - Intronic
999039764 5:148394741-148394763 GAAGATTTTCTCGTTGATACTGG + Exonic
1000712186 5:164594540-164594562 CAAGCTTCTCTCATTAATTTAGG - Intergenic
1002893005 6:1353151-1353173 GAATCTTCTCTCTTTTATATTGG - Intergenic
1003702030 6:8477160-8477182 TAAATTTCTTTCATAGATATAGG + Intergenic
1004541545 6:16554983-16555005 GGAGTTTCACTCATTGAGACAGG - Intronic
1004997883 6:21211726-21211748 GAAGTTTCTATCATGCATGTGGG + Intronic
1005729015 6:28677710-28677732 TCAATTTCTCTAATTGATATAGG + Intergenic
1009241568 6:61192510-61192532 GCAGTTTCTTGCATTGTTATGGG + Intergenic
1010418707 6:75646319-75646341 GATGTTGCTCTGCTTGATATTGG + Intronic
1012051356 6:94348794-94348816 GAACTTTATCTTATAGATATAGG + Intergenic
1015705084 6:136079229-136079251 GAAGTTTATCTCATTGTTTAAGG - Intronic
1015768388 6:136743562-136743584 GAAGTCTCATTCATTGATAATGG + Intronic
1017990043 6:159479004-159479026 GAAGTTTTTCTCATCAATTTTGG - Intergenic
1018449598 6:163894941-163894963 TAAGTTTCTCTAATTAATGTGGG + Intergenic
1018497055 6:164359394-164359416 GAAGTGGCTCTCAGTGAGATGGG + Intergenic
1018590315 6:165412752-165412774 GCAGTTTCTCTAATTGATTAAGG + Intronic
1020936270 7:14468226-14468248 GAAAATTCTATCATTGATATTGG + Intronic
1020953575 7:14710570-14710592 GAAGTTTCTCTCATTGATATTGG - Intronic
1021899890 7:25274916-25274938 CAACTTTCTCTTAATGATATAGG + Intergenic
1023283566 7:38595423-38595445 CATGTTTCTCTCATAGATAAAGG + Intronic
1030096085 7:105901199-105901221 CAAGTTGCTCTCATTCTTATTGG + Intronic
1032913375 7:136459514-136459536 CAAGTTTCTCTCTTGGATGTTGG + Intergenic
1032950780 7:136909125-136909147 GAATTTCATCTCATTGACATGGG + Intronic
1033779717 7:144654323-144654345 GATGTGTCTCTGATTGATCTTGG + Intronic
1035607141 8:937422-937444 GAAGTCTCTCTCATAGTCATGGG - Intergenic
1036814767 8:11893627-11893649 GAAGTTTTTCTCCTTCATGTTGG + Intergenic
1037703987 8:21300220-21300242 GAATTTTCTCTCCTTTATTTAGG - Intergenic
1038203392 8:25438774-25438796 GAAATTTCTCTGAGTCATATTGG - Intronic
1039734192 8:40313121-40313143 TAAGTTTATCTCATTAATCTTGG - Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1041922490 8:63198039-63198061 AAAGTTTATCTCAATGTTATAGG - Intronic
1043824045 8:84903250-84903272 GAAGTTATTTTCATTTATATGGG + Intronic
1048554698 8:135463385-135463407 GAACCTTCTTTCATTGATATGGG - Intronic
1052709493 9:32035990-32036012 TAGGGTTCTCTCATTGATATGGG - Intergenic
1056755192 9:89377229-89377251 GAAGCTTCTATCCTTGATTTGGG - Exonic
1060630731 9:125156220-125156242 AAAATTTCTCTAATTGATAATGG + Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1190168583 X:48093379-48093401 GAAGTTTCTCTCATTGCAAAGGG - Intergenic
1190441667 X:50481024-50481046 TAGGTTTCTATCTTTGATATTGG + Intergenic
1190929750 X:54937130-54937152 CAAGTTTCTGTCCTTGCTATAGG - Intronic
1191830856 X:65414595-65414617 GAAGTTTCTCTCACTTACAGAGG - Intronic
1192084817 X:68085719-68085741 GAAAGTTTTCTCATTAATATTGG - Intronic
1192088362 X:68125227-68125249 GAAGTTTTTCTTTTTGATGTAGG - Intronic
1192531199 X:71887935-71887957 GAATCTTCTCTCATTTATCTAGG + Intergenic
1195029740 X:100914779-100914801 GAAGTTTTTCTCAATGTTATTGG + Exonic
1197841124 X:130747820-130747842 GAAGTGGCTCTGATTGATTTTGG + Intronic
1199072424 X:143493902-143493924 AAAGATTCTCTCCTTGCTATTGG + Intergenic
1199196965 X:145042641-145042663 GAAGTTGCTCTCCTTTGTATAGG - Intergenic
1199542391 X:148971614-148971636 CAATTTTCTTTCATTAATATAGG - Intronic
1199618949 X:149682141-149682163 CAAGCTTCTCTCATTCATCTGGG + Intergenic
1201401118 Y:13605083-13605105 GAATTTACTTTCATTGATTTGGG - Intergenic