ID: 1020960502

View in Genome Browser
Species Human (GRCh38)
Location 7:14796975-14796997
Sequence GCAAAGAGACTATACTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020960501_1020960502 29 Left 1020960501 7:14796923-14796945 CCTTAAAAAAATCTTTAAAGGCA 0: 1
1: 1
2: 8
3: 81
4: 708
Right 1020960502 7:14796975-14796997 GCAAAGAGACTATACTGACATGG 0: 1
1: 0
2: 0
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020960502 Original CRISPR GCAAAGAGACTATACTGACA TGG Intronic
906035319 1:42747107-42747129 GCAATGTGACCATAATGACAGGG + Exonic
906054819 1:42907297-42907319 ACAAAGTGGCTATAGTGACAGGG - Intergenic
907645869 1:56242865-56242887 GCAAAGAGCTTATTATGACAGGG - Intergenic
909123274 1:71632192-71632214 AGAAAGAGATTATACTGATATGG - Intronic
909177581 1:72380401-72380423 GCAAAGGGCCTATACTCACAGGG - Intergenic
909722064 1:78784591-78784613 CTAAAGAGACCATACTCACATGG + Intergenic
911306061 1:96233656-96233678 GCAAAGAGAATATAGAAACACGG - Intergenic
915374747 1:155383558-155383580 GCAAACAGAATATACTAACCAGG - Intronic
917616851 1:176754707-176754729 GAATACAGACTATACTGACAGGG - Intronic
917704570 1:177619134-177619156 TCAAAGACACTATACTTACCTGG - Intergenic
918032727 1:180831591-180831613 GCAAAGAGAACATATGGACATGG - Intronic
918559429 1:185846830-185846852 GAAAAGGGACTATTCTGACTAGG - Intronic
918589445 1:186223888-186223910 TGAAAGAGACTTTACTGAGAGGG - Intergenic
919005483 1:191893886-191893908 GCAAATTGACTAAACTGAAATGG + Intergenic
922331030 1:224575553-224575575 GCAAAGCTACTCTATTGACAGGG - Intronic
922527516 1:226317015-226317037 TAAAAGAGACTGCACTGACATGG + Intergenic
922625679 1:227039204-227039226 TAAAGGAGACTAGACTGACATGG + Intronic
1065198517 10:23290332-23290354 AGAATGAGACTATACTGGCATGG + Intronic
1065400238 10:25291752-25291774 ACAAAGAGACTAAAATTACAAGG + Intronic
1068467986 10:57420134-57420156 GCAAAGAAAGTATACTGAGATGG + Intergenic
1068673495 10:59746527-59746549 GGAAATGGACTATACTGGCATGG + Intergenic
1071308630 10:84322906-84322928 GCAAAGAGGCTATGGTGACAGGG + Intergenic
1072469236 10:95696854-95696876 GCAAGGAGATTGTACTGAGATGG + Intergenic
1073824082 10:107300359-107300381 AAAAATAGACCATACTGACAGGG - Intergenic
1077467346 11:2739743-2739765 GCAAGGACACCATACTGACAGGG - Intronic
1082918464 11:58465380-58465402 TGAAGGAGATTATACTGACATGG + Intergenic
1088337904 11:108728869-108728891 GCGAAGACACTTTAATGACATGG - Intronic
1088938703 11:114431834-114431856 GCAAAGACAGTGTCCTGACAGGG - Intronic
1089468754 11:118704131-118704153 GAAAAGAAAAGATACTGACATGG - Intergenic
1094715690 12:33012958-33012980 TCACAGAGTTTATACTGACATGG - Intergenic
1096453398 12:51765068-51765090 GAAAAGAGCCTATACTGGCCAGG - Intronic
1096457342 12:51798618-51798640 ACAAAGTGACTATAGTGGCAGGG - Intronic
1099304009 12:80932994-80933016 ACAAAGAGAAGATACTGATAAGG - Intronic
1100692264 12:97050773-97050795 GCAAAGACACACTACTGCCATGG - Intergenic
1101189785 12:102320644-102320666 GCAAGGAGACTTTGCAGACAAGG - Intergenic
1107594495 13:41948590-41948612 TTAAAAAGACTATGCTGACAAGG + Intronic
1108743887 13:53369833-53369855 GCAAACAGACTATAATCAAAAGG - Intergenic
1110845705 13:80188454-80188476 GCAAATTGACTTTACTCACATGG + Intergenic
1111047506 13:82833902-82833924 GCAAAGAGCCAAGAGTGACATGG + Intergenic
1112620339 13:101048052-101048074 GCAAGGAGGCCATACTGACTTGG - Intergenic
1115695937 14:35898553-35898575 GCAAGGACATTACACTGACAGGG - Intronic
1115784768 14:36812654-36812676 TTAAAGAGAATATACTGGCATGG + Intronic
1118014124 14:61640927-61640949 GAAAAGGGACTATGCTGGCAGGG + Intronic
1120211989 14:81642280-81642302 ACACAGAGAGTATACTGAAATGG - Intergenic
1120539719 14:85737498-85737520 GAAAAGAGACAATAGAGACACGG + Intergenic
1121043661 14:90772263-90772285 GCACAGAGACCAGGCTGACAGGG + Intronic
1125530175 15:40407987-40408009 GGAAAGACACTATACTCACCAGG - Exonic
1125721697 15:41848185-41848207 GCCAAGAGCCTAGAATGACATGG - Exonic
1127886804 15:63208725-63208747 GAAGAGAGACAATTCTGACATGG - Intronic
1135232712 16:20724786-20724808 TCAAAGAGAATAAACTTACAAGG + Intronic
1138991655 16:62397363-62397385 GAAAAGAGTCTATATTCACATGG - Intergenic
1139681068 16:68563712-68563734 CCACAGAGACTACACTGATAGGG - Exonic
1141125834 16:81400332-81400354 GAAAAGAAACAAGACTGACAAGG - Intergenic
1144087265 17:11822063-11822085 GTAAAGAGCATTTACTGACAGGG + Intronic
1148149456 17:45388040-45388062 GCCATGAGACAATACTCACAAGG - Intergenic
1148869277 17:50646618-50646640 GCAAAGAGACTGTGATGGCATGG + Intronic
1151390031 17:73780499-73780521 GCAAAGAATCTTTAATGACATGG - Intergenic
1151412362 17:73939737-73939759 GGAAAGAGACCAGACTGACCTGG - Intergenic
1153546573 18:6212420-6212442 GAAAAGAAACTATACTTGCATGG + Intronic
1153867894 18:9289977-9289999 GGAAAGAAACTATACTTATATGG + Intergenic
1154079430 18:11241523-11241545 ACAAAGAGATTCTACAGACAGGG + Intergenic
1161124144 19:2546504-2546526 GCAAAGGGCCCACACTGACAGGG - Intronic
928858814 2:35831189-35831211 GCCAAGAGAGAATACTGACTTGG + Intergenic
930081759 2:47455665-47455687 GTAAAGAGACTGCATTGACATGG - Intronic
933093986 2:78155301-78155323 GCATATAGACTATACTTAAATGG + Intergenic
933113408 2:78433893-78433915 GCAAAGAGAATGAAGTGACATGG + Intergenic
936985296 2:118306322-118306344 GCCAAGAGACTATACATGCATGG - Intergenic
937998134 2:127710610-127710632 GCCAGGAGACTACACTGACTGGG + Intronic
941258841 2:163270737-163270759 GCAAAGAGATAAAACTGAAAGGG - Intergenic
945276576 2:207993569-207993591 ATAAAGAAACTATACTGCCATGG + Intronic
948323476 2:237091513-237091535 GTTAAGAGACTATCCTGACCTGG - Intronic
948508417 2:238447037-238447059 GCAAAGAGAGAATACTGAAGGGG - Exonic
1174260122 20:49288073-49288095 GCAAAAACACTATACTCAAAAGG - Intergenic
1175446095 20:59020574-59020596 GGAAAGACACCATAGTGACAGGG - Intronic
1177091008 21:16768625-16768647 GTAAAGCCACTATACTCACACGG - Intergenic
1177439588 21:21104057-21104079 GCAAAGAAATAATACTGAAAAGG - Intronic
1177811145 21:25926022-25926044 GCCAAGAAACAATACTGCCAGGG + Intronic
1178643919 21:34369060-34369082 GGAAAGAGAGCTTACTGACAGGG + Intronic
1179151256 21:38810225-38810247 GCAAATAGTCTATAGTCACATGG - Intronic
1181476759 22:23172996-23173018 GAAAAGACACTATTCTGAAAAGG - Intergenic
1183750654 22:39718432-39718454 GCAAAGAGACACTGCTGGCAGGG - Intergenic
954532522 3:51333284-51333306 CCAGAGAGAGTATCCTGACAAGG - Intronic
954788333 3:53111873-53111895 GGAAAGAGGCTAAACTGACTTGG - Exonic
959577464 3:107949929-107949951 GCAAAGAGATTCTGCTGACTTGG - Intergenic
961126816 3:124426140-124426162 GGAAAGAGCCTACACTGACAAGG - Intronic
961421489 3:126808622-126808644 CCAAAAAGACTACATTGACATGG - Intronic
962160905 3:132999350-132999372 GCAGAGAGACTGGTCTGACATGG + Intergenic
963458321 3:145574966-145574988 GTAAAGGGACTATGCAGACAAGG + Intergenic
963556248 3:146792490-146792512 GTAAAGAAACTAAACTGAGATGG + Intergenic
965005667 3:163019376-163019398 GCAGAGAGGATATACTGAAATGG - Intergenic
967718124 3:192787407-192787429 GCAAAGGGAATATACTGAAAGGG - Intergenic
970558399 4:17258906-17258928 GCAAAGAGCCTATCCTGAAGGGG - Intergenic
972141139 4:35960816-35960838 CAAAAGAGACTACATTGACATGG + Intronic
972242638 4:37209963-37209985 GCCAAGAGAGTAAACTGATATGG + Intergenic
972734458 4:41827105-41827127 TAAAAAAGACTGTACTGACATGG - Intergenic
974473995 4:62356201-62356223 GCTAAGATACTAAACAGACAGGG + Intergenic
978050919 4:104198935-104198957 GCAAAGTGACCATAATGCCAGGG - Intergenic
978451484 4:108839081-108839103 GGGGAGAGGCTATACTGACATGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
981134383 4:141193379-141193401 GCAGAGAGACTGGAATGACATGG - Intronic
986297547 5:6451391-6451413 GAAAAGAAAATATACTTACAAGG - Intronic
986603146 5:9494372-9494394 GCAAAGAGATTATATTCAGAAGG - Intronic
988674008 5:33412586-33412608 GCAAAGAGAATATACCAGCAGGG - Intergenic
988987214 5:36632175-36632197 GCAAAGAGACTATTGAGACAAGG + Intronic
989313484 5:40049472-40049494 TCAAGAAGACTATACTGAAATGG + Intergenic
990374315 5:55154121-55154143 GGAAAGAGACCACAGTGACAGGG + Intronic
991715226 5:69445572-69445594 GCAAACAGTATATACTGCCAGGG - Intergenic
993775519 5:91990513-91990535 GCCAAGTGACTATACTTTCAAGG + Intergenic
995823991 5:116272194-116272216 ACAAAAAGACTGCACTGACATGG - Intronic
997276086 5:132592321-132592343 TAAAAAAGACTACACTGACATGG - Intronic
998049108 5:139016618-139016640 ACCAAGGGACTATAATGACATGG + Intronic
998539788 5:142969843-142969865 GCAAAGAGACTATGCAGGAAGGG - Intronic
1000206434 5:159064494-159064516 GCAAAGAGAATTTTCTGAGATGG + Intronic
1000713867 5:164615461-164615483 TCAAAAAGACTATACTTTCAAGG - Intergenic
1001353869 5:171001952-171001974 GCAAATTGACTTTACTCACATGG - Intronic
1002586635 5:180252847-180252869 GCAGAGAGACCACAGTGACAGGG + Intronic
1004753460 6:18586752-18586774 GCAAAGAGATCGTACTGATATGG - Intergenic
1004907057 6:20245905-20245927 ACAAAGAAACTAGACTGCCATGG + Intergenic
1005379287 6:25217329-25217351 GCAAAGTGGCCATACTGGCAGGG + Intergenic
1006763872 6:36487574-36487596 GCAAAGGGACCAAACTGAAAAGG + Exonic
1009812452 6:68686003-68686025 GTAAAAAGATTATATTGACATGG - Intronic
1012294344 6:97501846-97501868 GGAAACAAATTATACTGACAAGG - Intergenic
1015444486 6:133287531-133287553 GCACTGAGACTAGACTGAAAAGG + Intronic
1015963250 6:138671690-138671712 GCAAAAAGAAGATACTGATAGGG + Intronic
1020960502 7:14796975-14796997 GCAAAGAGACTATACTGACATGG + Intronic
1022616435 7:31935766-31935788 GCAAAGAGACTTTAGTGCAAGGG - Intronic
1027712157 7:81618118-81618140 TGAAAAAGACTACACTGACATGG - Intergenic
1027798012 7:82718103-82718125 CCAAAGAGACTATACTGGGGTGG - Intergenic
1028957135 7:96706270-96706292 GAGAAGAAACTATGCTGACATGG + Intronic
1029268000 7:99357704-99357726 GCAAAGAGATTACACAGATATGG - Intronic
1029300860 7:99581340-99581362 GGAAACAGGCTTTACTGACATGG - Intronic
1029521040 7:101062639-101062661 GCAAAGAGAGAATTATGACAGGG - Intergenic
1039115742 8:34089542-34089564 GCAAGTAGACTATACTCAGATGG + Intergenic
1039126047 8:34203130-34203152 GAAAAGAGAATATACTGTAAAGG + Intergenic
1039646538 8:39290444-39290466 GCAAAAAGACTACACTGGCTTGG - Intergenic
1041309365 8:56498871-56498893 TCAAAAAGACTACATTGACATGG - Intergenic
1043977083 8:86595509-86595531 TCAAAGAGACTATATTCAAAAGG + Intronic
1048574536 8:135680339-135680361 GCACAGAGACTGTTCTGAAATGG - Intergenic
1050662083 9:7893618-7893640 GGAAAGAGAAGACACTGACAAGG + Intergenic
1051606578 9:18923105-18923127 GCAATGAGACTATAATGAAAAGG + Intergenic
1052284578 9:26770447-26770469 AAAAAAAGACTATATTGACATGG - Intergenic
1052312397 9:27081502-27081524 GCAAAGGGAACATACTAACAGGG - Intergenic
1053145511 9:35709355-35709377 GCAAGGCGCCTATTCTGACAGGG + Intronic
1053605487 9:39654422-39654444 GCAAAGACAGTATACTCCCATGG - Intergenic
1053863407 9:42411050-42411072 GCAAAGACAGTATACTCCCATGG - Intergenic
1054248054 9:62687994-62688016 GCAAAGACAGTATACTCCCATGG + Intergenic
1054562168 9:66722519-66722541 GCAAAGACAGTATACTCCCATGG + Intergenic
1055708200 9:79031697-79031719 GGAAAGATTCTATCCTGACATGG + Intergenic
1058148712 9:101440850-101440872 ACAAAGAGAAAACACTGACAAGG - Intergenic
1060770475 9:126327974-126327996 ACAATGAGATTATACTGAGAAGG - Intronic
1188478809 X:30616033-30616055 GCCAATTGACTATACTGATATGG - Intergenic
1190131007 X:47748969-47748991 GGAAAGAGGCTATACTGCAAAGG - Intergenic
1193565577 X:83072387-83072409 AAAAAAAGACTATATTGACATGG - Intergenic
1197397285 X:125942114-125942136 GAAAAGAAACTATATTAACAAGG - Intergenic