ID: 1020963249

View in Genome Browser
Species Human (GRCh38)
Location 7:14832771-14832793
Sequence TAGTGGAAGCAGATTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020963249_1020963253 26 Left 1020963249 7:14832771-14832793 CCTTGCTCAATCTGCTTCCACTA 0: 1
1: 0
2: 1
3: 17
4: 174
Right 1020963253 7:14832820-14832842 GATAACTACTCACAATGCAAAGG 0: 1
1: 0
2: 1
3: 22
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020963249 Original CRISPR TAGTGGAAGCAGATTGAGCA AGG (reversed) Intronic
901226325 1:7614841-7614863 AAGTGGATGCAGATGGAGCCAGG - Intronic
901369471 1:8784111-8784133 TGGTGGGAGCAGAATGAGCAGGG - Intronic
901760134 1:11465640-11465662 TAGTTGAAGCATCTTGAGCTGGG - Intergenic
902541213 1:17156421-17156443 GTGTGGAAGCAGCCTGAGCAGGG - Intergenic
902705447 1:18201124-18201146 TAGAGGAAGGAGCTTGAGCTGGG + Intronic
902729067 1:18356917-18356939 TAGGGGATGGAGATTGAGGATGG + Intronic
905382851 1:37575857-37575879 TAGTGGAAGTATCTTGTGCACGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
908474534 1:64474559-64474581 TATTGGAAGCTTACTGAGCATGG + Intronic
908769761 1:67585254-67585276 TGGAGGAAGCTGACTGAGCACGG + Intergenic
910588221 1:88901789-88901811 TAGTGGAAACTGATTGACTATGG + Intergenic
912770296 1:112457262-112457284 GAGTGGTAGCAGATGGAGAAGGG - Exonic
915006007 1:152637246-152637268 TAGTAGAAGAAGTTTGTGCATGG - Intergenic
915098259 1:153479396-153479418 TGGTGGAAGCAAAGTGAGAATGG - Intergenic
916098030 1:161368634-161368656 TGGTGCAGGGAGATTGAGCAGGG + Exonic
918598887 1:186328786-186328808 TTGTGGAAATAGATTGAGCAAGG - Intronic
919586827 1:199449318-199449340 TGGTGGGAGCACACTGAGCATGG + Intergenic
920148959 1:203888123-203888145 TACTGAAAGCAGACTGGGCACGG - Intergenic
923445421 1:234066384-234066406 TAGTTGGGGCAGAATGAGCAAGG - Intronic
924017679 1:239744965-239744987 TAGTGCAAGGACATGGAGCAAGG + Intronic
1065309111 10:24396983-24397005 GAGTGTTAGCAGAGTGAGCAGGG + Intronic
1067531204 10:47075064-47075086 AAGTGGAAGGCGTTTGAGCATGG + Intergenic
1071769228 10:88706163-88706185 AACTGGAAGCAGATTAATCATGG - Intergenic
1072322900 10:94268385-94268407 GAGTGGAAGCAGAGTTATCAAGG - Intronic
1078088146 11:8247040-8247062 TTGTGGAAGCAGATGGGCCAAGG - Intronic
1078635537 11:13046305-13046327 GAGTGGTGGCAGAATGAGCAAGG + Intergenic
1079787077 11:24686850-24686872 TCGGGGAAGCAGCATGAGCAGGG - Intronic
1082897851 11:58212183-58212205 TAGTGGAAGGAGATAGGGTATGG - Intergenic
1083015298 11:59447125-59447147 GAGTGGAAGCTGACTCAGCATGG + Intergenic
1084833123 11:71785142-71785164 GATTGGAAGCGGATTGAGGAAGG - Intergenic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1088624916 11:111723113-111723135 TAGTAGAAGCAGCTTGGCCAAGG + Intronic
1089004405 11:115078891-115078913 TAGTGAAAGAAGAGTGAGCTGGG - Intergenic
1091169196 11:133505483-133505505 AAGAGGAAGCAGATTGAGGGAGG - Intronic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1092409993 12:8245329-8245351 GATTGGAAGCAGACTGAGGAAGG + Intergenic
1095622709 12:44277720-44277742 TAGTGGCAGTAGATGCAGCATGG - Intronic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1097263280 12:57731653-57731675 TATTGGAATCAGTTTGAGGATGG + Intronic
1097648096 12:62260403-62260425 TAGTGGAAGAAGATGGCGGAAGG + Exonic
1098443970 12:70547273-70547295 TAATGGAAGTATATTGAGAAAGG + Intronic
1099048800 12:77757991-77758013 TAGTTGAAGCAAAGTAAGCAAGG - Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1102425585 12:112841762-112841784 TAGTGTATCCAGATTGAGAAAGG + Intronic
1102802339 12:115747257-115747279 TACTGGAAGCACAAGGAGCAAGG - Intergenic
1103397571 12:120619732-120619754 TAGTGGGAGTAGAGTGAGCTAGG - Intergenic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1104303651 12:127589741-127589763 TAGTGGTGGCAGATTAAGCCTGG + Intergenic
1104318859 12:127731189-127731211 CTGTGGATGCAGAGTGAGCAAGG - Intergenic
1106176745 13:27338231-27338253 TAGTGGGACCAGAGTGAGTAGGG - Intergenic
1107060653 13:36156265-36156287 TACGTGAAACAGATTGAGCAAGG + Intergenic
1108672199 13:52702895-52702917 TACTGAAAACAGATTGAGAAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112335233 13:98509730-98509752 TAAAGGAAGCAGATGGAACATGG - Intronic
1112676268 13:101705697-101705719 GAGGGGGAGCAGATGGAGCAAGG + Intronic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115114110 14:29858912-29858934 TATTGGAAGCAGATGGTGCCAGG - Intronic
1115963802 14:38864725-38864747 TGGTGGAAGGAGAGGGAGCATGG - Intergenic
1116940469 14:50785761-50785783 TAGTGGAAGCTGAGTGCGCCCGG + Intronic
1118816307 14:69316695-69316717 CAGTGGAAGCAAGTTCAGCAAGG + Intronic
1118886439 14:69870715-69870737 TAGTGGAAGCAGGACGGGCAAGG - Intronic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1123115279 14:105891637-105891659 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123117449 14:105901080-105901102 CAGCGGAAGCAGAGAGAGCAGGG - Intergenic
1123459242 15:20453937-20453959 TGGTTGAAGCAGAATGTGCAGGG - Intergenic
1123658818 15:22546481-22546503 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1124265480 15:28229774-28229796 TGGTTGAAGCAGAATGTGCAGGG - Exonic
1124312683 15:28640973-28640995 TGGTTGAAGCAGAATGTGCAGGG + Intergenic
1126495726 15:49288716-49288738 TAGTGGAACCAGATTGTGGCAGG + Intronic
1127616476 15:60690949-60690971 CTGTGGAAGGAGTTTGAGCAGGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1133350976 16:5100110-5100132 GATTGCAAGCAGATTGAGGAAGG + Intergenic
1133383599 16:5351067-5351089 TGGTGGAAGCAGGTTGACCCCGG + Intergenic
1138156644 16:54711891-54711913 TAGTTCAAGGAAATTGAGCAGGG - Intergenic
1140113500 16:72022821-72022843 TAGTGGAAACAGACTGAGCCCGG + Intronic
1140428711 16:74883437-74883459 TAGTGGCAGCTGATTTTGCAGGG - Intronic
1140545896 16:75808686-75808708 AAGTGGTAGCAGAGTGACCATGG - Intergenic
1146629958 17:34462758-34462780 TTGTGGAGGCTGCTTGAGCAGGG - Intergenic
1146634513 17:34494233-34494255 TAGTGGAAGCAGAGTGAACATGG + Intergenic
1151097450 17:71514814-71514836 TAGAGGAAGCAGTGTGAGAAAGG + Intergenic
1153591079 18:6674684-6674706 TAGTGGAAGGAGATAAAGCCTGG - Intergenic
1155117892 18:22787635-22787657 CAGTGAAAGCAGAGTGAGCGGGG + Intergenic
1159123413 18:64195936-64195958 AAGTGGAAGGAGATAGAGAAAGG - Intergenic
1160863303 19:1246661-1246683 CACTGGAAGCAGAATGAGCCTGG + Intergenic
1161652821 19:5495898-5495920 TTGTGGAAGAAGATGGAGCCAGG + Intergenic
1162308222 19:9888602-9888624 TGGCGGAAGCAGATGGAGTAGGG - Intronic
1164924868 19:32122722-32122744 CACTGGAAGCAGAGTGAGCCTGG - Intergenic
1165137883 19:33681831-33681853 CAGTGGAAGCAGCTTGAACAAGG - Intronic
1166056368 19:40291839-40291861 TGTTGGAAGCAGATTGATAAAGG - Intergenic
1166103417 19:40584830-40584852 TATAGGAAGCATATTGAGCCTGG - Intronic
1166832429 19:45646446-45646468 TTTTGGAAGCAGATTGACCTGGG + Intergenic
1168406634 19:56114070-56114092 CAGTGGCAGCAGTTTGGGCAAGG - Intronic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
932679966 2:73816473-73816495 TAGTAGAATCAGGTCGAGCAGGG - Exonic
936380303 2:111979174-111979196 TTGTGGAAGCTAATTGAGAATGG - Intronic
936980487 2:118260596-118260618 TAGTGGAAGGGGATTCAGCTTGG + Intergenic
939120090 2:138105869-138105891 GGGTTGAAGCAAATTGAGCAGGG - Intergenic
941969782 2:171337155-171337177 AAGAGGAAGCAGACTGGGCATGG - Intronic
942856307 2:180553557-180553579 AAGTGAAAGAAGATTGATCAAGG - Intergenic
943196298 2:184754989-184755011 TAGTGGGAGGTGATTGATCATGG - Intronic
945433330 2:209791494-209791516 TAGAGGAAACAATTTGAGCAAGG - Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
1170602781 20:17854392-17854414 CAGTGGCAGGAGATTGAGCTTGG - Intergenic
1172592476 20:36127507-36127529 TAGTGAAAGACGAATGAGCAAGG - Intronic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1175391019 20:58627466-58627488 AAGTGGAAGCGGCTTGAGCAAGG - Intergenic
1181392418 22:22593432-22593454 TAGGGGGAACAGATGGAGCAGGG + Intergenic
950904948 3:16529786-16529808 AAATGGAAACAGATTGGGCATGG - Intergenic
955177498 3:56631321-56631343 TAGAGGAAGCAGAGGGACCATGG - Intronic
957021547 3:75133921-75133943 TAATGGAAGGATATTGAGGATGG + Intergenic
957055231 3:75437453-75437475 GATTGGAAGCAGATTGAGGAAGG + Intergenic
957203994 3:77171006-77171028 TAATGGAAGCTGATTGTTCAGGG + Intronic
957386704 3:79505302-79505324 AAGAGGAAGCAGGTTGAGGAAGG + Intronic
958642256 3:96820069-96820091 TAGTGGAAACTGACTGAGCAAGG + Intronic
959957121 3:112251936-112251958 AAGTGGCAGCAATTTGAGCAAGG - Intronic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
961299593 3:125914220-125914242 GATTGGAAGCGGATTGAGGAAGG - Intergenic
962353793 3:134676915-134676937 TAGTGGAAGAAGCATGAGCGAGG - Intronic
962904263 3:139787949-139787971 TGGTTGTAGCAGATTAAGCAAGG - Intergenic
965151759 3:164986490-164986512 TAATGGAAACAGATTGAGTGAGG - Intronic
965208636 3:165755173-165755195 TATTGGAAGGATAATGAGCATGG - Intergenic
965382347 3:168005526-168005548 CAGTGGAATCAGACTGAGCTGGG + Intergenic
965670093 3:171138976-171138998 AAGTGGAAGCTGCATGAGCAAGG + Intronic
969755956 4:9150899-9150921 GATTGGAAGCAGATTGAGGAAGG - Intergenic
969816278 4:9690058-9690080 GATTGGAAGCGGATTGAGGAAGG - Intergenic
970507805 4:16749920-16749942 TAATGGAAAAAGATTGAGCCTGG - Intronic
977202235 4:94130712-94130734 TAATGGTAATAGATTGAGCAGGG - Intergenic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
982178198 4:152726328-152726350 TATTGGAAGCATATTAAGCATGG + Intronic
991445824 5:66698924-66698946 AAGTGGAAGCAGAGAGACCAAGG - Intronic
991598391 5:68327899-68327921 CATTGGAAGCAGATTGGGCAGGG - Intergenic
992992356 5:82297261-82297283 TAGCGGAAGCAGAGAGAGAAGGG + Intronic
995551417 5:113285508-113285530 GACTGGGAGCAGAGTGAGCAGGG - Intronic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
997874215 5:137534204-137534226 GAGTGGAAGCAGATTCCTCAGGG - Intronic
998299769 5:141006593-141006615 AAGTGGAAGCAGACTGAATAAGG + Intronic
998654532 5:144161946-144161968 TAGTGGTAACAAATTGAACAGGG - Intronic
1000155174 5:158543678-158543700 GAGTGGTATCAGATTCAGCAAGG - Intergenic
1002643663 5:180642460-180642482 TAGATGGAGCAGATGGAGCATGG + Intronic
1004258129 6:14083866-14083888 CAGTGGAAGCAGAGTGGGCTGGG - Intergenic
1004549309 6:16631237-16631259 AAGTGGAAGGAGAGTGGGCATGG - Intronic
1004774391 6:18826593-18826615 TAGCTGAAGCTGATTGAGTAAGG - Intergenic
1005561124 6:27042149-27042171 TTGTGGAACCAGATTGTACATGG - Intergenic
1008080334 6:47188134-47188156 GATTGGAAACAGATTGTGCAGGG + Intergenic
1008355438 6:50547340-50547362 TAGAGGAAGGTGCTTGAGCACGG - Intergenic
1009402294 6:63271167-63271189 TAGAGGAAGTAGAAAGAGCAAGG + Intergenic
1010563951 6:77385276-77385298 TGGTGGAAGCAGAATGTACAGGG - Intergenic
1011135592 6:84096647-84096669 TGATGGAAGCAGTTAGAGCAGGG + Intergenic
1011440184 6:87379268-87379290 AAGTGGAAGAAGAGTGGGCATGG - Intronic
1011547257 6:88494727-88494749 CAGTTAAAGCAGATTGACCAAGG + Intergenic
1017702594 6:157090010-157090032 TGGTGGAAGCTGACTCAGCACGG + Intronic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1021544360 7:21796420-21796442 GACTGGAAGCAGAATGAACATGG + Intronic
1022735411 7:33071195-33071217 TGGTGGAAGATGATTGATCATGG + Intergenic
1023584201 7:41711972-41711994 TATTGGAAGCAGACAGATCACGG - Intergenic
1024810235 7:53202461-53202483 TAGAGGAAGCAGTTTTAGTATGG - Intergenic
1026816760 7:73519425-73519447 AAGTGGAAGCACTTTGAGGATGG - Intronic
1028566135 7:92233345-92233367 TAGTTGTATTAGATTGAGCAAGG - Intronic
1030419554 7:109290667-109290689 TATTCAAAGCAGATTGATCAAGG - Intergenic
1030797819 7:113810538-113810560 TAATGGAGACAGAATGAGCAGGG + Intergenic
1033800507 7:144896193-144896215 TAGGGGAAGGAGACAGAGCAAGG + Intergenic
1033897650 7:146094450-146094472 AAATGCAAGCAGATGGAGCAGGG + Intergenic
1034094854 7:148397930-148397952 CAATGGAAGCATATTTAGCATGG + Intronic
1034327164 7:150247168-150247190 GAGTGGAAGGAGATTAACCAGGG - Intronic
1034766049 7:153722289-153722311 GAGTGGAAGGAGATTAACCAGGG + Intergenic
1036850359 8:12196412-12196434 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1036871723 8:12438685-12438707 GATTGGAAGCAGATTGAGGAAGG + Intergenic
1038487592 8:27947999-27948021 TAGTGGATGCAGTTTCAGCTTGG + Intronic
1043361891 8:79482318-79482340 CACTGGGAGAAGATTGAGCAGGG + Intergenic
1043801317 8:84614149-84614171 TAGTTGAAGCATATTGTGCCTGG + Intronic
1044225959 8:89718373-89718395 TAGTGAGAGCAGCTTGAGCTTGG - Intergenic
1044681111 8:94778526-94778548 AAGTGGAAGCGGAGGGAGCAGGG - Intronic
1044871639 8:96625726-96625748 TAGATGAAGCTGATCGAGCAAGG - Intergenic
1048087426 8:131198727-131198749 GAGTGACAGTAGATTGAGCAAGG + Intergenic
1051220390 9:14842676-14842698 GAGATGGAGCAGATTGAGCAAGG + Intronic
1052656661 9:31371844-31371866 TAGTGGAAGAAGAATGTGGATGG + Intergenic
1058133999 9:101287291-101287313 TAGTGGCATCATATTGATCAGGG - Intronic
1058729240 9:107834122-107834144 TAGAGGATCCAGATAGAGCATGG - Intergenic
1187520678 X:20011264-20011286 ACAGGGAAGCAGATTGAGCAGGG + Intronic
1189044382 X:37574749-37574771 TGGTTGAAGAAGAATGAGCAAGG - Intronic
1192546670 X:72019961-72019983 CAGAGGAAGCAGATGGAGAAGGG - Intergenic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1195410718 X:104566064-104566086 GAGGGGAGGCAGATTGAGAAAGG - Intergenic
1196188489 X:112770765-112770787 CAGTGGGACAAGATTGAGCATGG + Intergenic
1196434746 X:115664792-115664814 CAGTGGCAGGAGATGGAGCAGGG - Intergenic
1197693384 X:129525448-129525470 AAGTAGTAGCAGATAGAGCAAGG - Intergenic
1199557219 X:149122576-149122598 TAGTGGAAGCAGATTTATCCAGG + Intergenic