ID: 1020965057

View in Genome Browser
Species Human (GRCh38)
Location 7:14855140-14855162
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020965054_1020965057 29 Left 1020965054 7:14855088-14855110 CCTTTTTAAGACAAATTCAAGGT 0: 1
1: 0
2: 0
3: 21
4: 288
Right 1020965057 7:14855140-14855162 GGTCTATCTCAAAAAAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type