ID: 1020967302

View in Genome Browser
Species Human (GRCh38)
Location 7:14887454-14887476
Sequence CTGAGTGTACACAGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 428}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020967302_1020967306 -2 Left 1020967302 7:14887454-14887476 CCTTCTTCTCTGTGTACACTCAG 0: 1
1: 0
2: 2
3: 31
4: 428
Right 1020967306 7:14887475-14887497 AGTCCCTAAGGGGTCTCTTCTGG No data
1020967302_1020967309 5 Left 1020967302 7:14887454-14887476 CCTTCTTCTCTGTGTACACTCAG 0: 1
1: 0
2: 2
3: 31
4: 428
Right 1020967309 7:14887482-14887504 AAGGGGTCTCTTCTGGTTACAGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020967302 Original CRISPR CTGAGTGTACACAGAGAAGA AGG (reversed) Intronic
900267873 1:1768626-1768648 ATGTGGGGACACAGAGAAGATGG + Intronic
900466023 1:2825887-2825909 CTGTGAGGACACAGAGAAGGCGG - Intergenic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
901315893 1:8308035-8308057 GTGAGGACACACAGAGAAGATGG - Intergenic
903587093 1:24424459-24424481 ATGAAGGTACACAGAGTAGAGGG + Intronic
904973141 1:34434764-34434786 CTGAGTGCACACAAACAGGATGG + Intergenic
905788498 1:40776676-40776698 CTGGGAGTTCACAGAGATGATGG - Intergenic
906838462 1:49109493-49109515 CTGAGTGGACACTGGGAGGAAGG - Intronic
908661189 1:66437005-66437027 CTGAATGCACACAGCCAAGAAGG + Intergenic
909250539 1:73348217-73348239 CTGACTGGATACAGAGAATATGG + Intergenic
909774105 1:79462875-79462897 CTGAGTAGACACAGAGAGAATGG - Intergenic
910103080 1:83599207-83599229 CTGAGGCTACACAGAGCAGCAGG + Intergenic
911224438 1:95289622-95289644 CTGAATGTACCTAGAGAACATGG - Intergenic
911768614 1:101710547-101710569 CTGAGTGTTCAAAGATGAGAAGG - Intergenic
912735900 1:112149398-112149420 CTGAGGCTACACAGAGTAGTGGG - Intergenic
913333890 1:117690613-117690635 GAGACTGTACTCAGAGAAGAGGG + Intergenic
914949209 1:152097220-152097242 GTGAGGGTACAGGGAGAAGATGG - Intergenic
915314327 1:155019444-155019466 CTGAGTGGGAACAGAGATGACGG - Intronic
916157571 1:161869448-161869470 TTGAGTGTACACATAGATGTTGG + Intronic
916354247 1:163886424-163886446 CTGAGTTAAGACACAGAAGATGG - Intergenic
916480917 1:165213583-165213605 CTGAGTGCACACAGAGAAGTGGG + Intronic
916489197 1:165286568-165286590 ATGAGAGTACCCAGAGTAGAAGG + Intronic
916516061 1:165517768-165517790 CTGAGTACACACATAAAAGATGG + Intergenic
917064415 1:171076104-171076126 GTGAGAGGACACAGAGAAGTTGG - Intergenic
917137795 1:171804254-171804276 ATGAGAATAAACAGAGAAGATGG - Intronic
917380341 1:174399547-174399569 CTCAGATTACACAGGGAAGAAGG + Intronic
917690585 1:177464154-177464176 CTAAGTAAACACAGAGAAGTGGG - Intergenic
918625437 1:186651714-186651736 CTGAGAGTTCAGAAAGAAGATGG - Intergenic
918829835 1:189380489-189380511 ATGAGTGTTACCAGAGAAGAAGG - Intergenic
922221086 1:223609163-223609185 GAGAGTGTTCTCAGAGAAGAAGG - Exonic
922909900 1:229206575-229206597 CTCAGGGTCCAGAGAGAAGAGGG - Intergenic
923635403 1:235691519-235691541 GTGAGTGAACACTGAGAAGAAGG + Intronic
924932020 1:248740325-248740347 CTGAGTTTTCCCTGAGAAGAAGG + Intronic
1063309740 10:4940991-4941013 CTGAGGCTACAGAGAGAACAGGG + Intronic
1063324081 10:5079739-5079761 CTGAGGCTACAGAGAGAATAGGG - Intronic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1064936881 10:20688095-20688117 GTGAGTGAACACAGAGAATAAGG + Intergenic
1065785208 10:29206635-29206657 CAGAGGGTACACAGGTAAGAGGG + Intergenic
1066083463 10:31955032-31955054 CTGAGACTGCACAGAGAAGCAGG - Intergenic
1066955389 10:42165166-42165188 GTGAGTGTTCTCATAGAAGAAGG + Intergenic
1067751346 10:48973764-48973786 GGAAGTGTCCACAGAGAAGAAGG + Intronic
1068753605 10:60624957-60624979 GTGTGTGTGCACAGGGAAGAAGG - Intronic
1068879639 10:62035018-62035040 CTGTGTGTCCACAGACAAGGTGG + Intronic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1070452560 10:76576591-76576613 CTTGTTGTTCACAGAGAAGATGG - Intergenic
1071799996 10:89048467-89048489 GTGAGGGTGCAAAGAGAAGATGG + Intergenic
1071825647 10:89322795-89322817 CTGAGTTCAGACAGAGAAGTAGG - Intronic
1072924534 10:99604981-99605003 CTGAGGTTTCCCAGAGAAGAAGG + Intergenic
1073208382 10:101780477-101780499 CTGAGGATAGACAGAGAACAGGG - Intergenic
1074820420 10:117174264-117174286 CTGAGTATACCCCCAGAAGAAGG + Intergenic
1075416418 10:122267791-122267813 CTGAGTGTGCAAGAAGAAGATGG + Intergenic
1075485701 10:122820491-122820513 CTCAGTGTAAACACAGAAGCGGG - Intergenic
1076894421 10:133302871-133302893 CTGCGTGTCCACGGAGGAGATGG - Exonic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078114246 11:8429538-8429560 GTGAGTGGGAACAGAGAAGAGGG - Intronic
1078867440 11:15311193-15311215 CTGTGTGTACAGAGACATGAAGG - Intergenic
1079487472 11:20950507-20950529 CTGAGTGGACTCACAGGAGAAGG + Intronic
1079801074 11:24869681-24869703 TGAATTGTACACAGAGAAGATGG + Intronic
1080170056 11:29290318-29290340 GTGTGTGTACACAGAGAAAGAGG + Intergenic
1080694985 11:34595653-34595675 GTCCGTGTACACACAGAAGAAGG - Intergenic
1081273978 11:41123655-41123677 TTGAGTGAACTCAGAGAAGCTGG - Intronic
1081556316 11:44165309-44165331 CTGCTTGTCCACAGAGAGGAAGG - Intronic
1082770829 11:57206318-57206340 CTAGGTGTAAACAGAGAAGCTGG - Intergenic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084122172 11:67076026-67076048 CAGAGTTTACAGAGACAAGAAGG + Intergenic
1084218298 11:67663400-67663422 CTGTGTGGGCACAGAGAACAAGG + Intronic
1084712291 11:70851329-70851351 CTGGCTGTCCACAAAGAAGAAGG + Intronic
1084973301 11:72782769-72782791 CTCAGTTCACACAGAGCAGATGG - Intronic
1085229776 11:74956182-74956204 ATGAGGGTAGACAGAGGAGAGGG - Intronic
1085981411 11:81730809-81730831 CTGAGGCTGCACAGAGAAGCAGG - Intergenic
1086039779 11:82462338-82462360 CTGAGTCTTCAAAGAGAAGTAGG + Intergenic
1087081314 11:94173603-94173625 TTCAGTGTCCACACAGAAGAGGG - Intronic
1087978320 11:104578349-104578371 GTGAGGTTACAGAGAGAAGATGG + Intergenic
1087991078 11:104745630-104745652 CTGAATTTACAAAGAGAGGAAGG - Intergenic
1088135312 11:106550056-106550078 CTGAGGGTAGGCAAAGAAGAGGG - Intergenic
1089283541 11:117391276-117391298 CTGAGTGCACAAGGAGAAGAAGG + Intronic
1090066223 11:123505987-123506009 CTGATTGTAAACTGAAAAGATGG - Intergenic
1090778515 11:129985990-129986012 CTTAGTGTACACAGAGGTGTTGG + Intronic
1091023909 11:132125095-132125117 CTGAGTGTAGACAGATATGCGGG - Intronic
1091030598 11:132184174-132184196 CTGTGTTTACCCACAGAAGAGGG + Intronic
1091092918 11:132789824-132789846 CTGAGTGTTCATAGAGCTGAAGG + Intronic
1091975645 12:4822496-4822518 GTGAGGCTGCACAGAGAAGAAGG + Intronic
1092117629 12:6020667-6020689 CTGAGAGTCCAAAGAGGAGATGG - Intronic
1095701191 12:45192907-45192929 CTGAATCTAAACAGAGAAAAAGG - Intergenic
1096201670 12:49688024-49688046 CTGAGTGGATTCAGTGAAGAGGG - Intronic
1097630296 12:62052499-62052521 CTTAGAGCACAAAGAGAAGAGGG - Intronic
1099232362 12:80041604-80041626 CAGAGTGTTTACAGCGAAGAAGG - Intergenic
1100084854 12:90897516-90897538 CTGAGTCTAGAAAGAAAAGAGGG - Intergenic
1101242129 12:102848989-102849011 CTGAGTGTAGACAGAACACATGG + Intronic
1101477084 12:105061157-105061179 CTGAGTGTACAAGATGAAGAGGG - Intronic
1102486424 12:113260764-113260786 CTCAGTGTGCCCTGAGAAGAGGG - Intronic
1103076412 12:117986327-117986349 GTGAGGGTACAGTGAGAAGATGG + Intergenic
1105528929 13:21200731-21200753 CTGAGGCTGCACAGAGCAGAGGG + Intergenic
1105561454 13:21496296-21496318 CTGTGTGCACACAGAGAGAAAGG - Intronic
1107821800 13:44292610-44292632 CAGAGAGTATACAGTGAAGAAGG + Intergenic
1107929202 13:45292900-45292922 CTTAGTGGACATAGAAAAGATGG + Intergenic
1109409041 13:61940796-61940818 CTGAGTGTGCTCAGAGATGTGGG + Intergenic
1110098867 13:71570205-71570227 GTGAGTGTCCTCAGAGAATAAGG - Intronic
1111004040 13:82225377-82225399 CTGAGTGTACATCCAAAAGAAGG + Intergenic
1111251044 13:85601756-85601778 CTGTGTGTACACTGTGAAGAGGG - Intergenic
1111281416 13:86029828-86029850 CTGAGTGGACACAGATATTATGG - Intergenic
1111358751 13:87146135-87146157 CTGAGGCTGCACACAGAAGAAGG - Intergenic
1111681164 13:91443347-91443369 GTGAGGGCACAGAGAGAAGATGG + Intronic
1111778612 13:92693952-92693974 CTGAGTCTGCACAGAGTAGCAGG - Intronic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1112608044 13:100927336-100927358 CTGAGTATAAACAAGGAAGAGGG + Intergenic
1113797119 13:113065052-113065074 GTGTGCGCACACAGAGAAGAAGG + Exonic
1114552695 14:23542624-23542646 CTGAGTGCTCATACAGAAGAAGG - Intronic
1114622259 14:24103277-24103299 CTGTGTGCACACACAGGAGAGGG - Intronic
1115895434 14:38081325-38081347 GTGAGAGGACACAGAGAAGATGG - Intergenic
1115909421 14:38239173-38239195 CTGAGTCAACACATGGAAGATGG + Intergenic
1116674615 14:47889622-47889644 CTGAGTGTAAACAGAGAGAATGG - Intergenic
1116924041 14:50614767-50614789 CTCAGTGCACAGAGATAAGAAGG - Intronic
1117291471 14:54337985-54338007 CGTAGTGTATACAAAGAAGAGGG + Intergenic
1118056624 14:62085752-62085774 CTGAGTGTCGACATAGAATATGG - Intronic
1120031336 14:79645043-79645065 GTAAGTGAACACAGAGGAGATGG - Intronic
1120142591 14:80945184-80945206 CTGAGGATACAGAGAAAAGATGG - Intronic
1120661626 14:87257666-87257688 CTGAGGCTACACAGAGCAGCAGG - Intergenic
1121191341 14:92033337-92033359 CTGAGTTTACACAGAATAGTAGG + Intronic
1121262628 14:92577486-92577508 CAAAGTGAAAACAGAGAAGATGG - Intronic
1121471140 14:94155421-94155443 CTGAGGCTGCACAGAGAAGCGGG - Intronic
1121782567 14:96631344-96631366 CTGAGAGGACAGAGAGCAGATGG + Intergenic
1122066678 14:99178499-99178521 CTGAGAGTGCACAGAGCAGGAGG - Intronic
1122265417 14:100544534-100544556 CAGTGTGTTCACAGAGAAAATGG + Intronic
1123394039 15:19909131-19909153 GTGAGTGTTCTCATAGAAGAAGG - Intergenic
1123773518 15:23554021-23554043 GTGAGGATACAGAGAGAAGATGG + Intergenic
1125885196 15:43224170-43224192 CCGCGTGGACACAGGGAAGAGGG - Intergenic
1126477705 15:49083398-49083420 ATGAGTGTTCAAATAGAAGATGG - Intergenic
1127928916 15:63577454-63577476 CTGTCTGTACAAAGAAAAGAAGG + Intronic
1128403563 15:67311902-67311924 ATGAGTGGACAGAGAGAAGAGGG + Intronic
1129748708 15:78044095-78044117 CTGAGGGTTGACAGAGGAGAAGG + Intronic
1130162859 15:81418996-81419018 GTGAGGGTACAGTGAGAAGATGG + Intergenic
1130573962 15:85074044-85074066 CAGAGTGAACACAGAAAAGCAGG + Intronic
1132141328 15:99399133-99399155 CTGTGTGAACACCGAGAAAATGG + Intergenic
1134001355 16:10785461-10785483 CTAAGAGTACACAGAGAAACTGG + Intronic
1134301761 16:12997811-12997833 ATGTGTGTACACAGAGGTGAAGG - Intronic
1135463926 16:22669184-22669206 ATGGGTGTGCACAGAGAAAAGGG - Intergenic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1136767596 16:32800423-32800445 GTGAGTGTTCTCATAGAAGAAGG + Intergenic
1136800554 16:33070274-33070296 GTGAGTGTTCTCATAGAAGAAGG - Intergenic
1136868686 16:33780205-33780227 GTGAGTGTTCTCATAGAAGAAGG - Intergenic
1136902927 16:34060575-34060597 GTGAGTGTTCTCATAGAAGAAGG - Intergenic
1136958442 16:34813981-34814003 GTGAGTGTTCTCATAGAAGAAGG - Intergenic
1137755590 16:50899593-50899615 CTGAGGGGACACTTAGAAGAAGG + Intergenic
1140133608 16:72185475-72185497 CTGAGTGAACCCAAAGATGATGG - Intergenic
1140831321 16:78754183-78754205 CCGAGTGAAGACAGAGAAGATGG - Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141849487 16:86635517-86635539 CAGAGTTTCCCCAGAGAAGACGG + Intergenic
1142326776 16:89421017-89421039 CTGAGTGCAGACAGAGACCATGG + Intronic
1142422164 16:89978284-89978306 CTGTGTCTCCACAGAGTAGAAGG + Intergenic
1203069990 16_KI270728v1_random:1062449-1062471 GTGAGTGTTCTCATAGAAGAAGG + Intergenic
1203103491 16_KI270728v1_random:1335863-1335885 GTGAGTGTTCTCATAGAAGAAGG + Intergenic
1143585341 17:7847880-7847902 CTGAGTGCCCACAGAAAAGCGGG - Exonic
1144175649 17:12704231-12704253 GTCAGTGTATACAGAGAAAATGG + Intronic
1144759127 17:17697381-17697403 CTGAGAGTACACAGCGGTGATGG - Intronic
1145710737 17:26972227-26972249 GTGAGTGTTCTCATAGAAGAAGG - Intergenic
1147564911 17:41530018-41530040 GTGATAATACACAGAGAAGAGGG - Intergenic
1148038697 17:44689338-44689360 CTGCAGGTACACAGAGAGGAAGG - Intronic
1148455451 17:47808757-47808779 CTGAGTGGCCTCAGAGAAGTGGG - Intronic
1148477715 17:47940326-47940348 CTGAGAGTACACTGAGCAGGTGG - Intergenic
1148919622 17:51019103-51019125 CTGTGTCTTCACATAGAAGAAGG - Intronic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1150350200 17:64438348-64438370 CTGAGGCTGCACAGAGCAGAAGG + Intergenic
1152151153 17:78602214-78602236 CTGCGTGGACAAAGAGCAGACGG - Intergenic
1152258295 17:79252943-79252965 CTGAGTGTAGACGGCAAAGAAGG - Intronic
1153747764 18:8198020-8198042 CAGAGTGTCCACACAGAAGAAGG - Intronic
1154517088 18:15183227-15183249 GTGAGTGTTCTCATAGAAGAAGG + Intergenic
1156083061 18:33363642-33363664 CTTAGTATACACAGTGAAGAAGG - Intronic
1158101507 18:53834760-53834782 CTGAGTCTGCACAGAGCAGTGGG - Intergenic
1158299268 18:56033524-56033546 CTGAGGCTGCACAGAGCAGAGGG + Intergenic
1158400591 18:57118061-57118083 GTGAGTGGAGACAGAGAAGGAGG - Intergenic
1158564377 18:58542331-58542353 CTGTTTTTTCACAGAGAAGAAGG - Intronic
1159168258 18:64729451-64729473 CTGAGTGAATAAAGAGATGAAGG + Intergenic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159894036 18:73979926-73979948 GGGAGTGTAGACAGAGGAGAGGG - Intergenic
1162682124 19:12353239-12353261 GTGATTGTAGACAGAGAATAAGG - Intronic
1164077231 19:21831142-21831164 CTGAATGGACACACAGAAGTTGG + Intronic
1165113655 19:33515966-33515988 CTGAGTGTTCAAGGAGAAGGTGG - Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1167889570 19:52528564-52528586 CTAGATGTACACAGAGATGAAGG + Intronic
1167937868 19:52922495-52922517 CTGGATGTACAGAGAGATGAAGG - Intergenic
1167999453 19:53432848-53432870 CTGGATGTACAGAGAGATGAAGG + Intronic
1168467830 19:56618556-56618578 CTGAGTGTTCATAAAGAAGTGGG + Intronic
925538714 2:4943200-4943222 ACGTGTGTACACAGAGAAGAGGG + Intergenic
925924524 2:8660486-8660508 GTGACTGTCCACAGGGAAGAGGG + Intergenic
926438726 2:12864148-12864170 CTGAGTATTGCCAGAGAAGAAGG - Intergenic
927157673 2:20230889-20230911 TTCACTATACACAGAGAAGAAGG - Intergenic
927467438 2:23347950-23347972 CTGAGAGCACACAGTGAGGAAGG + Intergenic
929826081 2:45310532-45310554 CTGAGGATACTCAGAGAGGATGG - Intergenic
930417136 2:51103278-51103300 TTGAGTGTCCTCAGGGAAGAGGG - Intergenic
931958382 2:67453556-67453578 ATGAGTGCAGAAAGAGAAGAGGG - Intergenic
932284186 2:70518732-70518754 CTGAGTGTCCACAGAAGAGGTGG - Intronic
933513011 2:83264774-83264796 CTTAGTGTAAACACATAAGATGG - Intergenic
933918364 2:87019242-87019264 CTGAGGGTACACAGAGCACAGGG + Intronic
934004632 2:87750671-87750693 CTGAGGGTACACAGAGCACAGGG - Intronic
934937636 2:98476881-98476903 CTGTGAGTACCCAGAGAACAGGG - Intronic
935317384 2:101849035-101849057 ATGAGTGTACCCAGAAGAGAAGG - Intronic
935767590 2:106384704-106384726 CTGAGGGTACACAGAGCACAAGG - Intergenic
936733594 2:115412834-115412856 CTGAGTGTACACATAATAGATGG + Intronic
937889451 2:126926217-126926239 CTGAGGGTGCACAGAGCAGTGGG - Intergenic
938101421 2:128500330-128500352 CTCAGTCCACACAGGGAAGAGGG + Intergenic
938517419 2:132028179-132028201 GTGAGTGTTCTCATAGAAGAAGG + Intergenic
939092837 2:137799300-137799322 CTGAGGCTACACAGAGCAGCAGG - Intergenic
939835535 2:147125417-147125439 CTGAGGCTACACAGAGCAGCAGG - Intergenic
940117107 2:150220823-150220845 CTGAGAATACAGTGAGAAGATGG + Intergenic
940125571 2:150319795-150319817 CTGAAAGTCCAGAGAGAAGAAGG - Intergenic
940697881 2:157002684-157002706 GTGAATGTAGATAGAGAAGAGGG + Intergenic
940867159 2:158828765-158828787 TTGAAAGAACACAGAGAAGATGG + Intronic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941873746 2:170412448-170412470 CTGAGTCTTCAGACAGAAGAAGG - Intronic
942896696 2:181064937-181064959 TTGAGGGTCAACAGAGAAGAGGG - Intronic
945213811 2:207412324-207412346 TTGAGTGTATAAAGAGAGGAGGG - Intergenic
945297424 2:208184287-208184309 ATATGTGTACACAGAGAATAAGG + Intronic
945424243 2:209680203-209680225 CTGAGAATACATACAGAAGATGG + Intronic
945762469 2:213931018-213931040 CTGAGCGAACACAGGGAATAAGG - Intronic
947186239 2:227458125-227458147 CTGAATGTAGACAGATAAGAAGG - Intergenic
948258699 2:236587019-236587041 CTGAGGGTACACAGAGCACCTGG + Intergenic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
949048060 2:241881366-241881388 CTGAGGATGCACAGAGAAAAAGG - Intergenic
1168787471 20:552347-552369 ATGAGTGTAGACAGAGAAGGAGG + Intergenic
1169335063 20:4749060-4749082 CTGACTGAACAAAGAGAAGGAGG + Intergenic
1169942892 20:10956660-10956682 CTAAGTGTTCATAGATAAGAAGG - Intergenic
1170302277 20:14897851-14897873 GTGAGGGTACAATGAGAAGACGG - Intronic
1170326220 20:15157232-15157254 GTGAGTGCACAAAGAGAAGGAGG - Intronic
1170471321 20:16670834-16670856 CTGAGAGTAAAAAGAGAACATGG - Intergenic
1170560120 20:17550006-17550028 CTGAGGGTAAATAGAGAAGTGGG - Intronic
1170906948 20:20524829-20524851 CTCAGTGGAAACAGACAAGAAGG - Exonic
1171288190 20:23960779-23960801 CTGAGTATTGCCAGAGAAGAAGG + Intergenic
1173485692 20:43439375-43439397 CTATGTTTCCACAGAGAAGAGGG - Intergenic
1174127377 20:48316918-48316940 CTGAGTCAAGACAGAGAAGAAGG + Intergenic
1174777730 20:53361110-53361132 CTCAGTGTTGACAGAGAGGATGG - Intronic
1175740314 20:61415399-61415421 CTGACTGTACACATAAAAAATGG - Intronic
1176230675 20:64031177-64031199 CCCAGTGAACACTGAGAAGATGG - Intronic
1176896591 21:14385508-14385530 CTGATTGTAAACAAACAAGAAGG - Intergenic
1178047028 21:28706965-28706987 CTTAATGTACACAAAGAAGGTGG + Intergenic
1178060041 21:28842817-28842839 CTGATTGTATACAGAGAATCAGG + Intergenic
1178173347 21:30068083-30068105 GTAAATGGACACAGAGAAGAAGG - Intergenic
1178530373 21:33370991-33371013 CTGAGTGTACAGACAGAATGGGG - Intergenic
1178702533 21:34845577-34845599 CAGAGTGTTCACACAGAAGAGGG - Intronic
1179548769 21:42129561-42129583 CTGAGTTTAGACAGAGGAGTGGG - Intronic
1180569063 22:16699080-16699102 CTGAGAGTCCAAAGAGGAGATGG - Intergenic
1181870420 22:25893906-25893928 GTTAGTGTAGACAGAGAAGTGGG - Intronic
1182128262 22:27832249-27832271 CTGAATGTGCACAGACAGGAGGG + Intergenic
1182832191 22:33313267-33313289 CTGAGTGGACTGAGAGTAGAAGG - Intronic
1183375657 22:37463441-37463463 CTGTGTCTACACAAAGCAGAAGG - Intergenic
1184521267 22:44995739-44995761 TTGAGTGGAGACAGAGATGAGGG + Intronic
1203288466 22_KI270735v1_random:8455-8477 GTGAGTGTTCTCATAGAAGAAGG + Intergenic
950185441 3:10942464-10942486 CTGAGTCCACACAAAGAATATGG - Intergenic
950640471 3:14345211-14345233 CTGAGGGTTCACACAGAAGTAGG + Intergenic
950711294 3:14814592-14814614 ATGAGTGTGGACAGAGAAGAGGG - Intergenic
950797071 3:15518912-15518934 CTGTGTATACACAGAAAATAAGG - Intronic
951337060 3:21436161-21436183 GTGTGTGTACACACAGATGAGGG + Intronic
952023266 3:29048518-29048540 CAGAGAGTAAACAGAGCAGAAGG - Intergenic
952252059 3:31664936-31664958 CTGAGTGTCCAAAGAGCAGCTGG - Intronic
952523520 3:34185868-34185890 CTGAGTGCACACACAGGTGAAGG - Intergenic
952803409 3:37319965-37319987 CTGAGTGTACCCAGAGCTCAAGG + Intronic
953767343 3:45753685-45753707 GTGAGTATACACAAAGAAGAGGG - Intergenic
954294867 3:49668657-49668679 GTGGGTGTACTCAGAGCAGAGGG + Exonic
954865319 3:53724059-53724081 CTGAGTGTGAGCAGACAAGAAGG - Intronic
954871236 3:53769076-53769098 CTGAGAGAACACAGAGGAGTTGG - Intronic
955069515 3:55560492-55560514 CTGAGAGTACATGGAGAAGAGGG + Intronic
955077955 3:55631547-55631569 TTGAGTGTACACTGTAAAGATGG - Intronic
955195413 3:56801368-56801390 CTGAGAGTCCAGACAGAAGATGG + Intronic
955395540 3:58554532-58554554 CTGAGCCTACACAGAGCAGTAGG + Intergenic
956110611 3:65866853-65866875 CTCGGTGTAAACAGGGAAGAAGG + Intronic
956121786 3:65973480-65973502 CTCTGTGTACACACAGGAGATGG + Intronic
957392835 3:79600436-79600458 GTGAGAGAACACAGAGAAAAGGG + Intronic
959143659 3:102517263-102517285 GTGAGGGGACAAAGAGAAGATGG + Intergenic
959436957 3:106327268-106327290 CTGTCTGTAAACAAAGAAGAGGG + Intergenic
959708008 3:109357310-109357332 CTGAGGTTACAGAAAGAAGAGGG - Intergenic
960323175 3:116262941-116262963 CTGAGTGCTCAGTGAGAAGAAGG + Intronic
960424275 3:117487158-117487180 CTGCCTGCACACAGAGAAGGTGG + Intergenic
960727020 3:120680864-120680886 CTGAGTCTTCAGAGAGAAGTTGG - Intronic
961587315 3:127943193-127943215 TTGTGTGTATACACAGAAGAGGG + Intronic
962408926 3:135124314-135124336 CTGATGATACACAGAGAAGGAGG - Intronic
963202602 3:142600209-142600231 TTGAGTGTACACAGTGAGGAGGG + Intronic
964462046 3:156943687-156943709 CTGAGTAAACACAGAAGAGAAGG + Intronic
964477534 3:157110247-157110269 ATGAGTTTACACAGAGCAGCTGG - Intergenic
964934051 3:162059770-162059792 CTGAGGGTGCACAGAGAATCTGG + Intergenic
965066594 3:163857897-163857919 CTGAGGGTGCACAGACAAGGAGG - Intergenic
965703928 3:171486886-171486908 CTGATTGGATATAGAGAAGAAGG + Intergenic
965782005 3:172296037-172296059 CTGGGAGTCCACAGAGCAGAAGG - Intronic
966040102 3:175473907-175473929 TTGAGTGTACACACAGTAGTGGG + Intronic
966159605 3:176953972-176953994 CTGTGTGTTCTCAGAGAAGAAGG - Intergenic
967343087 3:188422727-188422749 CTGAATGAAGACAGAGAAAAGGG - Intronic
968574158 4:1357239-1357261 GTGAGGGTCCACAGAGCAGAGGG + Intronic
968787122 4:2630918-2630940 CAGAGCCTGCACAGAGAAGAGGG - Exonic
969040696 4:4293522-4293544 CTGACCATATACAGAGAAGATGG - Intronic
970133824 4:12900046-12900068 CTGAGATTACACAGAAATGATGG + Intergenic
970193524 4:13535828-13535850 CTGAGTGTAGCCACAGAAGGGGG + Intergenic
970558679 4:17261043-17261065 GTGAGGATACACTGAGAAGACGG - Intergenic
970921757 4:21402899-21402921 CTCAGTCTACACAGGGATGAGGG - Intronic
972255532 4:37351257-37351279 CTGAGGGTACAAAGAGGAGCTGG - Intronic
974925180 4:68289387-68289409 CTGAGGGTAAAGACAGAAGATGG + Intergenic
975189176 4:71439705-71439727 GTGAGTGTAGATAGAGCAGAGGG - Intronic
975758646 4:77596458-77596480 TTGGGTGTATACACAGAAGAGGG - Intronic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
977237644 4:94527828-94527850 GTGTGAGTAAACAGAGAAGAGGG + Intronic
977523365 4:98113589-98113611 CTGAATGTCCATAGTGAAGAAGG - Intronic
978490293 4:109304498-109304520 GAGAGAGTATACAGAGAAGATGG - Intergenic
978521163 4:109616726-109616748 ATGCTTGTACACAGAGAAGATGG - Intronic
978829233 4:113063396-113063418 TTGACTAGACACAGAGAAGAAGG - Intronic
979473919 4:121132555-121132577 CTCAGTATAAACAAAGAAGAGGG + Exonic
979904465 4:126269232-126269254 CTGAGTGAAGTCAGAGAACACGG + Intergenic
980509718 4:133770407-133770429 TTAAGTGTAAACTGAGAAGATGG + Intergenic
980746250 4:137020456-137020478 CTGAGAGTCTACAGAGAACAAGG + Intergenic
980770967 4:137372730-137372752 CTGAGGCCACACAGATAAGAAGG - Intergenic
980868891 4:138587426-138587448 CTGAGTGTCCACAGAAGAAAGGG + Intergenic
981470588 4:145130030-145130052 CTAAGTGAACACAGAAAATATGG - Intronic
981653059 4:147080633-147080655 ATGAGAGTGCACAGGGAAGAGGG - Intergenic
981833331 4:149027326-149027348 CTGTATATACACAGAGAATAAGG - Intergenic
982128208 4:152202743-152202765 CTGAAGGTACACTGAGATGAAGG - Intergenic
982312059 4:153996787-153996809 CAGAGTCTACACAAATAAGAAGG - Intergenic
983198085 4:164830426-164830448 ATGAGTTTACACAGGTAAGAGGG + Intergenic
983737743 4:171084747-171084769 ATGAGTATTGACAGAGAAGAAGG + Intergenic
983836016 4:172386367-172386389 GTGAGGGTACAATGAGAAGATGG - Intronic
985641451 5:1065225-1065247 CTGAGAGGACACAGAGGGGACGG + Intronic
986527354 5:8694467-8694489 CTGAGTCTACAGAGACAAAACGG - Intergenic
986894336 5:12347375-12347397 CTGAGGCTGCACAGAGAAGCAGG - Intergenic
986923352 5:12716274-12716296 ATGAGTGTTGCCAGAGAAGAAGG + Intergenic
987188577 5:15450507-15450529 CTGAGGATACCCATAGAAGATGG + Intergenic
988473914 5:31565849-31565871 CTGAGGCTACACAGAGCAGGGGG + Intergenic
988579825 5:32459082-32459104 CTGAGTCTGCACAGAGCAGCGGG + Intergenic
988821233 5:34888140-34888162 GTGAGTTTACAGAAAGAAGATGG + Intronic
990332336 5:54740278-54740300 CTGAGTGAGCAGAGAGATGAGGG - Intergenic
990766128 5:59185063-59185085 CTTAGTATACACAGACAACATGG + Intronic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
991650502 5:68847739-68847761 ATGAGGGCAGACAGAGAAGAGGG + Intergenic
991726711 5:69542743-69542765 CTGTGTGTAATCAGAAAAGAAGG - Intronic
991868246 5:71085131-71085153 CTGTGTGTAATCAGAAAAGAAGG + Intergenic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
995390948 5:111639862-111639884 CTGAGGCTGCACAGAGAAGGGGG - Intergenic
995825352 5:116291015-116291037 CTGAGTCTATACATTGAAGAAGG + Intronic
997125683 5:131224784-131224806 CTGAATGGCCACAGAGAAAAGGG + Intergenic
997159585 5:131594126-131594148 CTGAGGCTACACAGAGTAGCAGG - Intronic
998368617 5:141647022-141647044 GTGAGTGTACACCGTGGAGAGGG - Intronic
998641059 5:144011799-144011821 CTGGGTGGACTCAGAGCAGATGG + Intergenic
998908991 5:146937500-146937522 CTGTGGGTCCACAGAGAGGAGGG + Intronic
1001279197 5:170374252-170374274 CTGAGTCTTCACTGTGAAGAAGG + Intronic
1001499060 5:172214409-172214431 CAGAGGCTAAACAGAGAAGAGGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002769152 6:275047-275069 ATGAGTGTGCACAGAAAATATGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003831595 6:10017799-10017821 GCAAGTGTACACAGATAAGAAGG + Intronic
1003923751 6:10857486-10857508 CTGAGGTTCCTCAGAGAAGAAGG + Intronic
1004562690 6:16765255-16765277 CTGAGTGTAAACACAGCAAAAGG - Intergenic
1004816450 6:19316286-19316308 GTGAGGATACAGAGAGAAGACGG + Intergenic
1006994160 6:38242587-38242609 GTGTGTGTACACAAACAAGATGG + Intronic
1007028970 6:38609512-38609534 GTGTATGTACACATAGAAGAAGG - Intronic
1007306563 6:40911324-40911346 ATGAGAGAACACAGAGAGGAAGG + Intergenic
1007806566 6:44454371-44454393 GTGAGTGTATACCCAGAAGAGGG - Intergenic
1009877812 6:69528097-69528119 ATGAGTGTACACAGCAGAGATGG - Intergenic
1011350229 6:86414995-86415017 CTGAGTGTAAAGAGAGGAGGTGG - Intergenic
1012027515 6:94015977-94015999 TTGAGTGTTCACATATAAGAAGG + Intergenic
1013218641 6:108055686-108055708 CTGAGAGTACAGAAAGTAGATGG - Intronic
1014743002 6:125168380-125168402 GTGAGGGTACTCAGAGAAGAGGG - Intronic
1015440004 6:133237054-133237076 CTGAGTGTAAGCATGGAAGAAGG + Intergenic
1016262121 6:142184718-142184740 CTGAGTGTCCACAATGTAGAGGG + Intronic
1016657826 6:146542607-146542629 TTGAGTATACACCCAGAAGAGGG + Intergenic
1017067940 6:150547628-150547650 CTGCCTGGACACAGACAAGAGGG - Intergenic
1017232420 6:152087534-152087556 CTGAGTGACCACATAAAAGAGGG - Intronic
1018108039 6:160507602-160507624 CTGAGAGTACACAGAGCATGAGG + Intergenic
1018128426 6:160704832-160704854 CTGAGGGTACACAGAGCACAAGG - Intronic
1018733063 6:166667894-166667916 CTGAGTGTACAAAGAAAAGAGGG + Intronic
1019540168 7:1547754-1547776 CCAGGTGTACGCAGAGAAGAAGG - Exonic
1020741800 7:12029388-12029410 CTGGGTGTATACAGACCAGAAGG + Intergenic
1020829737 7:13079612-13079634 CTGAGAATAAACAGAGAAGTTGG - Intergenic
1020967302 7:14887454-14887476 CTGAGTGTACACAGAGAAGAAGG - Intronic
1021009850 7:15448339-15448361 ATGAGTTTACAATGAGAAGATGG + Intronic
1021419758 7:20432621-20432643 CTGAGAGTCCACAGTGGAGATGG - Intergenic
1022509229 7:30924599-30924621 CTGTGTCTACACTGACAAGAGGG - Exonic
1022746523 7:33178381-33178403 CTGAGTGGACACAATGAAGGTGG - Intronic
1022958581 7:35403586-35403608 ATGAGGTTACACAGAGAAGTTGG + Intergenic
1023255404 7:38307838-38307860 AAGAGTGTTCACAGAGAAAATGG + Intergenic
1023350702 7:39317770-39317792 TCAAGTGCACACAGAGAAGAAGG - Intronic
1023864864 7:44233813-44233835 CTGAGGGAACACAGAGGTGACGG + Intronic
1024140450 7:46457916-46457938 CTGAGGTTACAGAAAGAAGAGGG + Intergenic
1024446402 7:49484547-49484569 ATGAGTGAATACAGGGAAGACGG + Intergenic
1024473447 7:49787188-49787210 CTAAGGGTACACAGAGCAGTAGG - Intronic
1025482653 7:61002381-61002403 GTGAGTGTTCTCATAGAAGAAGG - Intergenic
1025562768 7:62390212-62390234 ATGAGTGTTCTCATAGAAGACGG - Intergenic
1026154775 7:67817444-67817466 ATGAGGATACAGAGAGAAGATGG - Intergenic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028438789 7:90834985-90835007 GTGAATGTAGACAGAAAAGAGGG + Intronic
1028813524 7:95117589-95117611 CTGAGTCTAGGCAGAGAAAATGG + Intronic
1029504320 7:100953085-100953107 ATGTCTGTACTCAGAGAAGATGG - Exonic
1029504626 7:100955341-100955363 GTGTCTGTACTCAGAGAAGATGG - Exonic
1029505159 7:100959208-100959230 ATGTCTGTACTCAGAGAAGATGG - Exonic
1030463124 7:109865810-109865832 CTCAGTGTACAAATAGAAAAAGG + Intergenic
1030469001 7:109939328-109939350 CTGAGGCTACACAGAGCAGCAGG + Intergenic
1030823220 7:114121246-114121268 GTGAGGATACAAAGAGAAGATGG + Intronic
1031258760 7:119489493-119489515 CTGAGGCTGCACAGAGAAGTGGG + Intergenic
1031270364 7:119641723-119641745 CTGAATTTAAAGAGAGAAGAAGG - Intergenic
1034703226 7:153115498-153115520 CTGAGTATAGTTAGAGAAGAGGG + Intergenic
1036641421 8:10586505-10586527 CAGATTGTACAGAGAGAAGTAGG + Intergenic
1038895230 8:31775389-31775411 ATGGGTGTACATAGACAAGATGG + Intronic
1039166206 8:34682807-34682829 TTGAGAGTACACAAAAAAGAAGG + Intergenic
1039737104 8:40344787-40344809 ATGAGTGCACAGAGAGATGATGG - Intergenic
1039858518 8:41436815-41436837 CTGGGTATAAAGAGAGAAGAAGG + Intergenic
1039862132 8:41468148-41468170 AGGAGAGAACACAGAGAAGAAGG + Intergenic
1040055601 8:43054883-43054905 ATGAGTGGCCACAGAGAGGAGGG + Intronic
1040537582 8:48323329-48323351 CTGAGTGGAGACAGGGCAGAGGG + Intergenic
1041036796 8:53799818-53799840 CTGAGTTTACAGTGAAAAGATGG + Intronic
1041048414 8:53909102-53909124 CTGATTTGACACAGAGAAGTTGG + Intronic
1041469336 8:58191358-58191380 AAGAGGGAACACAGAGAAGATGG + Intronic
1042639178 8:70914241-70914263 TTGAGTATACACATAGAAGTAGG + Intergenic
1042907596 8:73787855-73787877 CTGAGTGTTTTCAGTGAAGATGG - Intronic
1043822814 8:84889538-84889560 CAGGGTGTAGAAAGAGAAGATGG - Intronic
1044100135 8:88124865-88124887 GTGAGTATGCACAGAGAAGCTGG - Intronic
1044181408 8:89200070-89200092 CTTAGTGTAACCAGTGAAGATGG + Intergenic
1044290055 8:90457757-90457779 GTGAGTTTACAGTGAGAAGATGG + Intergenic
1044727168 8:95203268-95203290 CTGAGTTTTCACAGATCAGAAGG + Intergenic
1045214735 8:100136671-100136693 CCAGGTGAACACAGAGAAGAGGG - Intronic
1045234048 8:100334323-100334345 CTGTGTGGAAACAGAGCAGAGGG - Intronic
1045967700 8:108044379-108044401 CTGAGAGTGCACAGAGAGGGGGG - Intronic
1046580935 8:116091602-116091624 GTGAGTGGAGACAGAGAAAAGGG - Intergenic
1046715654 8:117563649-117563671 CAGAGTGTTAACAGAAAAGAAGG - Intergenic
1047183705 8:122613464-122613486 CAGAGTTTCCAGAGAGAAGATGG - Intergenic
1047818724 8:128494718-128494740 GTGAGGATACAAAGAGAAGATGG - Intergenic
1048526224 8:135205568-135205590 CTGAGGCTGCACAGAGAAGCTGG - Intergenic
1049338323 8:142098391-142098413 TTGACTGTACAAAGAGGAGAGGG + Intergenic
1049492770 8:142913940-142913962 CTGGGTGTACAAGGAGAAGGAGG - Intronic
1050299326 9:4241128-4241150 CAGAGTGTGCACAAAGAAGCAGG - Intronic
1050795511 9:9535838-9535860 GTGTGTGTACACACAGGAGAAGG + Intronic
1052268601 9:26603222-26603244 CAGAGTGTACACAATGAAGTGGG - Intergenic
1052363803 9:27589276-27589298 GTGAGGGGACACAGAGAACAGGG + Intergenic
1052990690 9:34517886-34517908 GTGGGTCTACACAGAGAGGAAGG + Intronic
1053449838 9:38184187-38184209 CTGAGTGTACAGAGATCACATGG + Intergenic
1055798100 9:79998266-79998288 CAGCTTGTACACAGAGAAAATGG + Intergenic
1057420365 9:94907413-94907435 CACTGTGTACACACAGAAGACGG - Intronic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1059630024 9:116111449-116111471 GTGAGGGTAAACAGAGAAGTTGG + Intergenic
1060046854 9:120348350-120348372 CTGAGTGTCCACTGAGAAAGTGG + Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1186217732 X:7317822-7317844 CAGAGAGAACACAGTGAAGAGGG - Intronic
1186654422 X:11597381-11597403 CTCAGTGGTCACAGATAAGATGG - Intronic
1186704650 X:12128432-12128454 CGGAGTCTGCACAGAGCAGAGGG + Intergenic
1188836951 X:34969760-34969782 CTGATTTTAAAAAGAGAAGAGGG + Intergenic
1189001866 X:36956800-36956822 TTGAGTATACACACAGAAGAGGG - Intergenic
1189011329 X:37048578-37048600 CTGAGGCTGCACAGAGAAGCAGG - Intergenic
1189972985 X:46436805-46436827 TTGAGTGTTCACTGAGTAGATGG + Intergenic
1190391430 X:49935596-49935618 CTGAATTTATAGAGAGAAGAAGG + Intronic
1190444129 X:50505986-50506008 CTGAGTTAACATAGAGAAGTTGG + Intergenic
1192230381 X:69260575-69260597 CTGAGGTTACAGTGAGAAGATGG - Intergenic
1193061564 X:77213574-77213596 CTGAGACTGCACAGAGAACACGG - Intergenic
1193990385 X:88299747-88299769 GTGAGGGTACAGGGAGAAGATGG + Intergenic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1196025025 X:111033115-111033137 CTGTGTGTACAGAGAGAGGGAGG - Intronic
1196667744 X:118333889-118333911 CTGACTTTAACCAGAGAAGAAGG - Intergenic
1196903565 X:120410107-120410129 CTGAGGGTGCACAGACAAGGGGG + Intergenic
1198521779 X:137460451-137460473 CTCAGTGGGAACAGAGAAGAGGG + Intergenic
1198790331 X:140338642-140338664 CTGAGAATACCCAGAGCAGATGG - Intergenic
1199511672 X:148629876-148629898 CTGGGGGTTCACAGAGAAGAAGG - Intronic
1199577046 X:149322363-149322385 CTGAGGGCCCACAGAGGAGAAGG + Intergenic