ID: 1020967371

View in Genome Browser
Species Human (GRCh38)
Location 7:14888387-14888409
Sequence TAAGATGCCCAGTAAGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020967371_1020967377 25 Left 1020967371 7:14888387-14888409 CCTCTTCCTTACTGGGCATCTTA 0: 1
1: 0
2: 2
3: 17
4: 185
Right 1020967377 7:14888435-14888457 TTTTCCTCTTTGTGTGAATAAGG 0: 1
1: 0
2: 3
3: 54
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020967371 Original CRISPR TAAGATGCCCAGTAAGGAAG AGG (reversed) Intronic
900544489 1:3220852-3220874 TAAGCTGCCCAGGGAGGAAAGGG + Intronic
901736974 1:11318900-11318922 TAAGATGCCGTGTAAGCTAGTGG + Intergenic
902080573 1:13817991-13818013 TGAGATGCCCAGCATGGAAGTGG + Intronic
902375484 1:16028281-16028303 TTCGTAGCCCAGTAAGGAAGGGG - Intronic
903046075 1:20565282-20565304 TTAGAGGCCAAGTTAGGAAGTGG + Intergenic
903189467 1:21648767-21648789 GATGATGCCCAGAAAGGGAGAGG + Intronic
904471742 1:30740484-30740506 TAAGAGGCCCTGCCAGGAAGAGG + Intronic
904980307 1:34495425-34495447 TAAGATGCCTGGTTATGAAGGGG + Intergenic
905324641 1:37142332-37142354 TAGGATGCCCAGTAGGGTAAGGG + Intergenic
905454136 1:38075948-38075970 AAAGGTTCCCAGGAAGGAAGAGG + Intergenic
912211114 1:107558068-107558090 TAAAATGGCAAGTAAGGAAGAGG - Intergenic
912211121 1:107558131-107558153 TAAAATGGCAAGTAAGGAAGAGG - Intergenic
913319699 1:117579529-117579551 TCAGAGGCAGAGTAAGGAAGGGG - Intergenic
917520534 1:175744439-175744461 CAAAATGTCCAGTAAGCAAGTGG - Intergenic
920885722 1:209926026-209926048 AAAAATGCCAAGTAAGGAGGAGG + Intergenic
920938588 1:210459071-210459093 TAAGATGGCCCGTTTGGAAGTGG + Intronic
922595661 1:226810874-226810896 TCAGATGCCCAGAAGGCAAGTGG - Intergenic
924813791 1:247425498-247425520 TAACATGCCCAAGGAGGAAGAGG + Exonic
1063067857 10:2626990-2627012 GAAAAGTCCCAGTAAGGAAGTGG + Intergenic
1067522670 10:47019959-47019981 TAAGATGATTAGTAAGGAAATGG + Intergenic
1067686204 10:48467096-48467118 TAGGATGCCCAGGCAGGAAGAGG - Intronic
1068770478 10:60815010-60815032 TAAGAGGCCAAGTGAGGGAGGGG + Intergenic
1070179378 10:73998988-73999010 TAAAATGCCCAGGAGGGAGGAGG - Intronic
1070501319 10:77075282-77075304 TACGATGCCCAGGAAGTAAAAGG - Intronic
1071512336 10:86269903-86269925 TAAGACCCCCTGTAGGGAAGGGG + Intronic
1071953591 10:90732702-90732724 AAAGATGGCGAATAAGGAAGTGG + Intergenic
1072680260 10:97500643-97500665 TCTGATGCCAAGAAAGGAAGGGG - Intronic
1075502153 10:122984924-122984946 TAATATACCCAGGTAGGAAGTGG + Intronic
1075688703 10:124380974-124380996 CAAGATGCCCAGCCAGGCAGGGG + Intergenic
1078197504 11:9148403-9148425 CAATCTGCCCAGTAAGTAAGGGG + Intronic
1079593279 11:22207841-22207863 AAAAATGCCCAGTTAGAAAGTGG + Intronic
1080362498 11:31532190-31532212 GAAGATGGGCAGCAAGGAAGAGG + Intronic
1080478841 11:32624461-32624483 AAGGATGCCCAATAGGGAAGTGG + Intronic
1081426369 11:42930536-42930558 TTTGATGCCCAGAAGGGAAGGGG + Intergenic
1081694038 11:45097224-45097246 TCACATGGCCAGTAAGGGAGAGG - Intronic
1083658921 11:64243165-64243187 TGAGAAGGCCAGTGAGGAAGAGG - Intronic
1084079875 11:66815044-66815066 GAAGACGACCAGTAGGGAAGAGG + Intronic
1086599387 11:88613954-88613976 TAACATGCTAAGTAAAGAAGAGG + Intronic
1087275329 11:96155304-96155326 TGAGATTCCCATAAAGGAAGTGG + Intronic
1088505850 11:110526232-110526254 GAAGATGCCTTGTAAAGAAGGGG - Intergenic
1088812886 11:113403374-113403396 GGAGATGCCCAGTAAGAAATTGG - Intergenic
1089785525 11:120904385-120904407 TAAGAGGCACAGAAAGGAACAGG - Intronic
1090870455 11:130741246-130741268 TTAGAGTCCCAGAAAGGAAGAGG - Intergenic
1093711289 12:22333121-22333143 TAAAATTCCCAGAAAGGAAGCGG + Intronic
1093935661 12:24997385-24997407 AAAGATGCCTAGGAAGGATGAGG - Exonic
1098883089 12:75936585-75936607 TAAGTTGCTCAGTGAGGCAGGGG - Intergenic
1102021907 12:109688846-109688868 TAAGACACACAGTCAGGAAGTGG - Intergenic
1103899821 12:124297572-124297594 AAAGTTGCCCAGCCAGGAAGCGG + Intronic
1106901293 13:34357173-34357195 TGAGAAGCACAGTAAGAAAGGGG + Intergenic
1107438745 13:40404843-40404865 CAACATGGCCAGTAAGGAGGCGG - Intergenic
1107736666 13:43406092-43406114 TAATATGCCCAGATATGAAGAGG - Intronic
1110185277 13:72667165-72667187 ACAGATGCCCAATAAGGAAAAGG + Intergenic
1112138616 13:96612532-96612554 TTAGATGCCCAGTAAGCAGTTGG - Intronic
1113005639 13:105699060-105699082 GAACAGGGCCAGTAAGGAAGAGG - Intergenic
1118440099 14:65804429-65804451 TCAGAGGCCCAGAAAGGAGGAGG - Intergenic
1118783526 14:69026510-69026532 TGAGGTGATCAGTAAGGAAGGGG - Intergenic
1120000808 14:79301323-79301345 TAAGATGGAAAGGAAGGAAGAGG + Intronic
1121432810 14:93899516-93899538 TAAGATGCACAGTCATGAAAAGG + Intergenic
1121708062 14:96015559-96015581 TTATAAGCCAAGTAAGGAAGAGG + Intergenic
1124214016 15:27791724-27791746 TCAGATGGCCAGTCAGGAGGTGG + Intronic
1125761314 15:42097402-42097424 AAGGATGCCCAGCAAGGGAGAGG - Intergenic
1125999890 15:44198767-44198789 TAGGATGCCCAGAATGGAAAGGG + Intergenic
1126181115 15:45785858-45785880 TAAGATAGCCAGTAAAGAGGTGG + Intergenic
1128146160 15:65333542-65333564 TAAGGTGCCTAGGAGGGAAGGGG - Intronic
1128452533 15:67814235-67814257 TAAGAGTCCCAGCAAGGCAGTGG + Intergenic
1130508978 15:84572659-84572681 AAAGATGCCCTGAAAAGAAGGGG - Intergenic
1134821437 16:17250722-17250744 TGAGGAGCCCAGGAAGGAAGAGG - Intronic
1135496042 16:22951988-22952010 TAGGATGCCCATTAGGGCAGTGG - Intergenic
1136078299 16:27832000-27832022 GAAAATGCCCACTGAGGAAGGGG - Intronic
1138270774 16:55694421-55694443 TCAGATGCCCAGGCAGGCAGGGG + Intronic
1139459184 16:67108745-67108767 TGAGATGTCCAGTAGGGAAGTGG - Intergenic
1141931376 16:87206447-87206469 AAAGTTGCCCAGGAAGGAGGTGG + Intronic
1146390244 17:32415536-32415558 CAGGATGGCCAGCAAGGAAGAGG - Intergenic
1150454022 17:65292749-65292771 CAGGATGCCAAGTGAGGAAGAGG - Intergenic
1150576058 17:66432011-66432033 AAACATGCCCTGAAAGGAAGGGG + Intronic
1150723028 17:67629424-67629446 CAACATGCCCAGTAGGGACGGGG + Intronic
1151498596 17:74474424-74474446 CAAACTGCCCACTAAGGAAGGGG - Intronic
1152274138 17:79344473-79344495 TGAGAAGCCCAATGAGGAAGGGG - Intronic
1152975923 18:218255-218277 TTAGTTGCCTAGTAAGTAAGTGG + Intronic
1153188787 18:2515614-2515636 TTAGATGCCCAGAAAGGAAGAGG + Intergenic
1153546985 18:6218388-6218410 GAAGAAGCCCAGCATGGAAGGGG - Intronic
1153872487 18:9334244-9334266 ACAGCTGCCCTGTAAGGAAGCGG - Intergenic
1156519233 18:37707617-37707639 TAAGTTGCCCAATTAAGAAGTGG - Intergenic
1158792049 18:60793422-60793444 TAACATGCCCACTGAAGAAGGGG - Intergenic
1159741597 18:72178218-72178240 TGACATGCCCAAAAAGGAAGAGG + Intergenic
1160378928 18:78434711-78434733 TTATATGCCCAGTAATGAAATGG - Intergenic
1164291969 19:23877423-23877445 TAAGGCGCCCAGGAAAGAAGGGG - Intergenic
1164302195 19:23972250-23972272 TAAGGCGCCCAGGAAAGAAGGGG - Intergenic
1164474564 19:28565225-28565247 TAATATTCACAGTAATGAAGAGG - Intergenic
1166358287 19:42240314-42240336 TAAGATTCCCAGAAAGGAAGAGG - Intronic
1167786162 19:51637987-51638009 TAAGATCCCCAGAAAGTAACTGG - Intronic
927828806 2:26330350-26330372 TAGAATGACCAGAAAGGAAGAGG - Intronic
928921488 2:36532729-36532751 CAAGATGCACAGCTAGGAAGTGG - Intronic
930765463 2:55080726-55080748 TCATATGCCCAGTTAGGAAGGGG - Intronic
933642900 2:84783204-84783226 TGACATGCACAGTCAGGAAGTGG - Intronic
934130954 2:88948195-88948217 TAAGATTCCGGGTAGGGAAGGGG + Intergenic
936574921 2:113644960-113644982 TATGATACCCTGTAAGGATGGGG - Intergenic
937312103 2:120908816-120908838 TATTTTGCCCAGAAAGGAAGGGG + Intronic
937313409 2:120915993-120916015 CCAGTTGCACAGTAAGGAAGGGG - Intronic
940873637 2:158880493-158880515 TAAGACTCCCAATATGGAAGGGG - Intergenic
941933010 2:170961273-170961295 TAAGATGCCACGTAAGCCAGGGG - Intronic
945539684 2:211069329-211069351 TATGATCTCCAGTAAGCAAGTGG - Intergenic
947594235 2:231400674-231400696 TCAGATGCCCAGGAAGGAAAAGG + Exonic
948917228 2:241040488-241040510 TCAGATGGCAAGGAAGGAAGGGG - Intronic
1173263688 20:41459262-41459284 TAAGAAGCCCAGTAAGTACTGGG + Intronic
1173646184 20:44634479-44634501 TAAGGTGCCCAGTAAGCACAGGG - Intronic
1174274536 20:49394193-49394215 TAGGATCCACAGGAAGGAAGGGG + Intronic
1175446604 20:59024384-59024406 CAAGATGTCCACCAAGGAAGTGG + Exonic
1178360500 21:31945329-31945351 TAAGATGCCCAGGAAGAGGGGGG - Intronic
1179085087 21:38209114-38209136 TCAGGTTCCCAGCAAGGAAGAGG - Intronic
1179470940 21:41609921-41609943 TAAGATGGCCTGGAAGGGAGGGG + Intergenic
1182693433 22:32179381-32179403 CAAAATCCCCAGAAAGGAAGTGG - Intergenic
1183371983 22:37437990-37438012 CAAGATCACCAGTCAGGAAGTGG - Intergenic
1185157566 22:49203358-49203380 CAAGATGCAGAGGAAGGAAGGGG + Intergenic
951249073 3:20373136-20373158 TTAAATACCCAGTGAGGAAGAGG + Intergenic
951361975 3:21736084-21736106 TAAGTTTCCCACCAAGGAAGAGG - Intronic
951651960 3:24960524-24960546 TAAGAGGCAGAGTAAGGCAGAGG + Intergenic
952906559 3:38142846-38142868 TAAAATGCCCAGTATTAAAGGGG - Exonic
953734019 3:45475935-45475957 TAAAATGCCTTTTAAGGAAGAGG - Intronic
956070129 3:65440139-65440161 TAAAATGCTCAGTTAGAAAGAGG + Intronic
956594841 3:70955750-70955772 TAAGATAGCCAGGAAGGCAGTGG + Intronic
958568248 3:95844170-95844192 TCAGAGGCTCAGAAAGGAAGAGG + Intergenic
960725220 3:120663202-120663224 TAAGAAAGACAGTAAGGAAGAGG + Intronic
961518416 3:127452884-127452906 CAAGGTGCTCAGTAAGGAAGAGG - Intergenic
964424182 3:156534295-156534317 TAAGATGTGCAGGAACGAAGGGG + Intronic
965834623 3:172837822-172837844 TAAGATGCAAAGAAATGAAGAGG - Intergenic
967797802 3:193617007-193617029 TAAGGTACACAGCAAGGAAGTGG - Intronic
969218585 4:5744194-5744216 AAAGATGCCCAGGCAGGAAGGGG - Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
969653853 4:8484807-8484829 AACCATGCCCAGGAAGGAAGGGG + Intronic
974106541 4:57475785-57475807 TAACATGCCCAACAAGGAATTGG + Intergenic
975733712 4:77361840-77361862 TGAGATGCCAAGCAAGGAAGTGG + Intronic
975734233 4:77366214-77366236 TCAGTTGCCCAAGAAGGAAGAGG + Intronic
977878412 4:102176204-102176226 TATAATGTCTAGTAAGGAAGAGG + Intergenic
978018101 4:103773612-103773634 TAACATGCCCATAAAGGAATGGG - Intergenic
980327895 4:131371911-131371933 TAAGATTCTGAGTAAGGAGGAGG - Intergenic
982097173 4:151933758-151933780 TAACTTGCCCAGTTAGAAAGTGG - Intergenic
983136006 4:164081491-164081513 AAAGAAGCCCAGTAAAGAAGAGG + Intronic
984496659 4:180506468-180506490 TAAGATGGCTTGTAAGTAAGAGG - Intergenic
985043296 4:185914778-185914800 AAAGATGCCGAGACAGGAAGAGG - Intronic
985219362 4:187686576-187686598 TGGCATGCCCAGTAATGAAGGGG + Intergenic
986494664 5:8330479-8330501 TCAGATGGCCAGCAAGAAAGTGG - Intergenic
988993180 5:36690745-36690767 CAGGATACCCAGAAAGGAAGGGG - Intergenic
991533373 5:67639306-67639328 GAAGATGCTCAGCATGGAAGTGG - Intergenic
991667628 5:69014941-69014963 TAACATACCCAATAAGGTAGGGG - Intergenic
991980973 5:72230342-72230364 TAAGATGCCTAGCTATGAAGTGG - Intronic
993214361 5:85000359-85000381 TTAGATTCCCAGTTAGGTAGGGG - Intergenic
994303086 5:98170745-98170767 TAAAATGCACAGTAAGAAATAGG + Intergenic
996988610 5:129600760-129600782 TAAGATCTACAGTAAGAAAGAGG + Intronic
999437126 5:151571512-151571534 TAAGATGAGCTGTAGGGAAGGGG + Intergenic
1000225596 5:159258355-159258377 TAAAATGCCCAGTAAGTGAATGG + Intergenic
1001158287 5:169291844-169291866 TAACATCCCCAGTAAGGAACAGG - Intronic
1001309727 5:170602274-170602296 TAAGATGCAGAGGAGGGAAGTGG - Intronic
1003087325 6:3070244-3070266 TAAGCTGCCCAGTTTGAAAGAGG - Intronic
1003374375 6:5562282-5562304 TAGGGTGCCCAGTTAAGAAGTGG + Intronic
1004404411 6:15318618-15318640 TGAGATGCCTTGTAAGGAAAGGG - Intronic
1004850886 6:19698331-19698353 GAAGATATGCAGTAAGGAAGGGG - Intergenic
1006665413 6:35689390-35689412 TAAGATGCCCAGTCGGGACTGGG + Intronic
1007707543 6:43799925-43799947 TAAGAACCCCAGGAAGGCAGAGG + Intergenic
1008893361 6:56522449-56522471 TAAGATCCCCAGTAAGGGGAAGG - Intronic
1011027202 6:82882055-82882077 TAAGATGAACAGTAGGGAATCGG - Intergenic
1011541197 6:88432098-88432120 TAGGATGGCCAGCAATGAAGAGG - Intergenic
1011811801 6:91140677-91140699 TATGCTGCCCAGGGAGGAAGAGG + Intergenic
1013545176 6:111149630-111149652 TAAGGTGCCCAGTATGAGAGGGG - Intronic
1015561979 6:134525739-134525761 TAAGATGGCCAATCAGCAAGAGG + Intergenic
1015707491 6:136104011-136104033 TGAGAGGCCAAGTAAGCAAGAGG + Intronic
1017753610 6:157511073-157511095 GAAGATGCCTACTAAGGAAGAGG - Intronic
1019780303 7:2935859-2935881 GAGGCTGCCCAGCAAGGAAGTGG + Intronic
1020449410 7:8304504-8304526 TAAGAAGCCCAGTATAGATGAGG - Intergenic
1020967371 7:14888387-14888409 TAAGATGCCCAGTAAGGAAGAGG - Intronic
1022371795 7:29778296-29778318 TAAGATACCCAGGAAGAAAGAGG + Intergenic
1024896663 7:54268781-54268803 TAGGATGCCAGGCAAGGAAGGGG - Intergenic
1025155966 7:56606117-56606139 TAAGGTACCCAGGAAAGAAGGGG - Intergenic
1025762150 7:64405032-64405054 TAAGGTGCCCAGGAAAGAAGGGG + Intergenic
1027834872 7:83227926-83227948 TAAGATGCTCTGTAAGTAAATGG + Intergenic
1030857542 7:114580091-114580113 TAAGATTTTGAGTAAGGAAGTGG + Intronic
1033589878 7:142800450-142800472 TAAGGTGCTCAGGAATGAAGGGG - Intergenic
1033653340 7:143358255-143358277 TAAGATGCCTAGAAAGGGATAGG - Intronic
1038340154 8:26679359-26679381 TAGGATTCACAGTGAGGAAGGGG + Intergenic
1039662098 8:39478802-39478824 TAACTTACCCAGTAAGGAAATGG + Intergenic
1041260867 8:56019559-56019581 TGAGATAGCCAGGAAGGAAGAGG + Intergenic
1043663002 8:82769691-82769713 TAAAATGACTAATAAGGAAGAGG + Intergenic
1045276706 8:100713079-100713101 GAAGATGCACAGAAAGTAAGTGG - Exonic
1045925440 8:107575667-107575689 TATGATGCCCAGTATTGCAGAGG + Intergenic
1047520208 8:125590168-125590190 TCAGATGCCCAGCTAGTAAGAGG - Intergenic
1047555466 8:125924590-125924612 GAGGATGCCTAGGAAGGAAGTGG - Intergenic
1049302806 8:141880493-141880515 CATGATGCCCAGCAAGGAGGGGG - Intergenic
1051121266 9:13754973-13754995 TCAGATGCTCATTAAGGAATTGG - Intergenic
1051589752 9:18765575-18765597 TTTGTTTCCCAGTAAGGAAGTGG - Intronic
1055820825 9:80261156-80261178 ACAGATGCCCAGAAATGAAGAGG + Intergenic
1057529580 9:95832121-95832143 TAAAATGGTCAGTGAGGAAGGGG + Intergenic
1057870395 9:98712393-98712415 CAAAATCCCCAGAAAGGAAGCGG - Intergenic
1057879893 9:98785444-98785466 GAAGATGCCCAGTTGGGCAGCGG - Intronic
1058967544 9:110050931-110050953 GAAGATGCCCTTTAAGGAAAGGG - Intronic
1059702550 9:116789878-116789900 TAAGATGCCTTGTAAAGATGTGG - Intronic
1059742402 9:117164784-117164806 TCAGATGCCCAGTGAGGGATGGG - Intronic
1186192801 X:7082716-7082738 TAGGATGCCCATGCAGGAAGTGG - Intronic
1187176152 X:16897979-16898001 TGAGATGCCCACCAAGGAAGAGG + Intergenic
1189471343 X:41316696-41316718 TTCCATGCCCAGGAAGGAAGGGG + Intergenic
1192468662 X:71377258-71377280 TAAGATGCTGAGTATGGAATGGG + Intronic
1193311422 X:80014895-80014917 TAACATGGTCAGTAAGGCAGAGG - Intronic
1194558108 X:95387647-95387669 AAAGATCCCCAGTAAAGAAAAGG - Intergenic
1197153277 X:123243407-123243429 GAACATGGCCAGTGAGGAAGAGG - Intronic
1198126862 X:133653451-133653473 TAAGATGTCCAGGAAGGTGGAGG + Intronic
1199417905 X:147607736-147607758 AAAGATGCCTAGTTAGCAAGAGG + Intergenic