ID: 1020970252

View in Genome Browser
Species Human (GRCh38)
Location 7:14928831-14928853
Sequence ATGGAGACTCAGATGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 1, 2: 21, 3: 89, 4: 484}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020970252 Original CRISPR ATGGAGACTCAGATGGATGA GGG (reversed) Intronic
900724415 1:4206233-4206255 ATAGAGACTCAGAAGTGTGAGGG - Intergenic
900993422 1:6108112-6108134 ATGGAGGCATAGAGGGATGATGG + Intronic
900993468 1:6108307-6108329 ATGGAGAGACGGAGGGATGAAGG + Intronic
900993571 1:6108734-6108756 ATGGAGAGACAGAGGGATGGAGG + Intronic
903236182 1:21952241-21952263 AGTGAGACTCAGAGAGATGACGG + Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903858189 1:26349528-26349550 ATGGAGACCCAGAGAGATCAAGG - Intronic
904883780 1:33720444-33720466 AAGGGGATTCAGAAGGATGAAGG + Intronic
904990990 1:34592448-34592470 ATGGATACTCAGAGTGGTGAGGG - Intergenic
906312237 1:44762163-44762185 CTGGAGAGTCAGCTGGGTGAGGG + Intronic
906607213 1:47180974-47180996 AGGGAGACAGAGATGGATGGAGG + Intergenic
906699691 1:47848944-47848966 ATGGGGACCCACAGGGATGAAGG - Intronic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906789516 1:48646267-48646289 AAGGAGGCTCAGAGTGATGACGG + Intronic
907651207 1:56296424-56296446 ATTGAGGCTCAGATTGAGGAAGG - Intergenic
907680537 1:56559260-56559282 AAGGAGACTAATATGGATAAAGG + Intronic
909188081 1:72514989-72515011 ATGGAGACTCAGGTTGGTGTTGG + Intergenic
909283576 1:73787989-73788011 ATGGAGTCTTTGATGGATTAGGG - Intergenic
909470648 1:76024187-76024209 ATGAAGACTCAGATGTGTGCCGG + Intergenic
910166169 1:84329573-84329595 ATGGAGAAGCAGCTGGATTAAGG + Intronic
911400679 1:97370803-97370825 AAGGTGACACAGATGGCTGATGG + Intronic
912521325 1:110246923-110246945 ATGGAGACTCAGAGGGAGAGAGG - Intronic
912833547 1:112974817-112974839 ATGGAGGCACACATAGATGAAGG + Intergenic
913001777 1:114587757-114587779 ATGGAAACTCAGATGTTTGCAGG - Exonic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915707612 1:157861490-157861512 ATGGAGACAAATTTGGATGAGGG - Intronic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916790199 1:168118442-168118464 ATGGAGACTCACGAGGGTGAGGG + Intronic
917214086 1:172659700-172659722 ATGGAGGCTCATAGGGGTGAAGG + Intronic
918238244 1:182600284-182600306 GTGGAGACTCAGGTGTGTGAGGG + Exonic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
918943851 1:191034926-191034948 ATGGAGAATCAGATTTATGGAGG - Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919412527 1:197264130-197264152 ATGGAGACTTGGAAGGTTGAGGG - Intergenic
919420470 1:197364139-197364161 ATGGAGACAAAACTGGATGAGGG - Intronic
919590908 1:199500824-199500846 ATGGAAACTCAGAGGGGTGGGGG + Intergenic
920387869 1:205580911-205580933 AGGGACACTCACATTGATGAGGG - Exonic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
923469912 1:234281238-234281260 ATGAAGACACAGAAGGGTGATGG + Intronic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
923987302 1:239395620-239395642 ATGCAGACTCTGATCCATGAGGG + Intronic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
1063078507 10:2741425-2741447 ATGGAGACTGGGAAGGGTGAGGG - Intergenic
1063409817 10:5828662-5828684 ATAGAAACTGAGATGGAGGACGG + Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064506021 10:16030958-16030980 ATGGAGACTCAGATCTTTGCTGG + Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065747962 10:28859106-28859128 ATGGAGCCACAGGTGGATGAAGG - Intronic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066444499 10:35469654-35469676 ATGGAGAGTCAGACGGGAGATGG + Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1067968518 10:50942282-50942304 ATGGAGCCTCAGAAGTGTGAGGG + Intergenic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1070266930 10:74912318-74912340 ATGGATAGACAGATAGATGAAGG + Intronic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070515890 10:77205598-77205620 ATGCAGTCTTAGATTGATGAAGG + Intronic
1070715191 10:78715289-78715311 ATGGAGACTTAGATGTGTGGAGG - Intergenic
1071729110 10:88230400-88230422 GGGGCGACTCAGGTGGATGAGGG - Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072261855 10:93683958-93683980 ATGTAGACTTAGGTGGTTGATGG - Intronic
1072885912 10:99273713-99273735 AAGGACAGACAGATGGATGATGG + Intergenic
1073248784 10:102109190-102109212 ACGGAGACTCAGATGGGAGAGGG + Intronic
1075642552 10:124075284-124075306 ATGGAGCCTCAGATGTGTGGAGG - Intronic
1075785980 10:125050461-125050483 ACGGAAACCCAGAGGGATGAAGG + Intronic
1075803346 10:125166970-125166992 ATGGAGACACGACTGGATGAGGG - Intergenic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076117809 10:127912819-127912841 ATGGAGAGATGGATGGATGAAGG + Intronic
1077163861 11:1126375-1126397 ATGGGGACACACATGGATGGTGG + Intergenic
1078141492 11:8696468-8696490 ATGGAGTCTCAGATGTTTGCTGG - Exonic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079315817 11:19407031-19407053 ATGGAGGCTCATTTGGATGGAGG + Intronic
1080426335 11:32158205-32158227 AAGGAGACCCTGATGGATGCTGG + Intergenic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080804088 11:35636002-35636024 ATGGAGACTGGGCTGGATGGGGG + Intergenic
1081626451 11:44658856-44658878 ATGGAGACATGGATGGATGAAGG + Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1084445115 11:69199148-69199170 ATGGAGATATGGATGGATGATGG - Intergenic
1086011437 11:82108431-82108453 ATGAAGACTCAGGTGGTTGAGGG - Intergenic
1088202981 11:107360115-107360137 ATAGAGACTCAGAAGAATAAGGG - Intronic
1088554126 11:111044332-111044354 AAGGAGACTCAGAAGGGTGGGGG - Intergenic
1089666444 11:120023310-120023332 GTGGAGTCTCAGATGGATGCCGG - Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091016362 11:132054539-132054561 AGGGAGAGGCAGATGGATGGAGG + Intronic
1091240193 11:134046935-134046957 ATGGTGACTCACCTGGCTGAGGG - Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092051769 12:5475992-5476014 ATGGAGGCCCTGATGGAAGAAGG + Intronic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095458169 12:42412250-42412272 ATGGAGACTCACAAGCAGGAGGG - Intronic
1095923717 12:47557582-47557604 ATGGAGACGGAGGTAGATGAAGG + Intergenic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098109359 12:67105505-67105527 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099582571 12:84469689-84469711 ATGGAGATTCAAAAGGGTGAAGG + Intergenic
1101411494 12:104472564-104472586 ATGGAGACTCAGAAGGATTTAGG + Intronic
1102111084 12:110366260-110366282 ATGGAGACTGATAGGGAAGATGG + Intergenic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1103932813 12:124459537-124459559 CAGGAGACTCAGATTGCTGAGGG - Intronic
1104062480 12:125280501-125280523 ATGGACACTCAGATTGAGCAAGG - Intronic
1104723994 12:131065003-131065025 AGGGAGAATCTGATGAATGAGGG - Intronic
1104968031 12:132518239-132518261 ATGGACAGACAGGTGGATGATGG - Intronic
1105249011 13:18679293-18679315 ATGGATAGTTAGATGGATAAGGG + Intergenic
1106483710 13:30155226-30155248 AGGGAGGCTCAGAGGGCTGAAGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1108956107 13:56159371-56159393 AGGGAGTCTCAGAAGGCTGAAGG + Intergenic
1110094257 13:71496547-71496569 ATTGAGACTCAGAAGGGTGTGGG + Intronic
1110837948 13:80106479-80106501 ACAGAGAAACAGATGGATGAAGG - Intergenic
1110884847 13:80619819-80619841 AAGGACACACAGGTGGATGAAGG - Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113668806 13:112160987-112161009 ATGGAGAGTCAGAGAGCTGAAGG - Intergenic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114661987 14:24352609-24352631 TTGGAGACTCAGATGTGGGAAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116016706 14:39416380-39416402 ATGGATATTCAGATTCATGAAGG - Intronic
1116142921 14:41023104-41023126 ATGGTGACTCAGAGGAATGAGGG - Intergenic
1116401254 14:44510389-44510411 ATGGAGACTCAGAAGTGTGTGGG - Intergenic
1116657470 14:47671163-47671185 ATGGTGTCACAGTTGGATGAGGG - Intronic
1117238809 14:53807149-53807171 ATGGACAGACAGCTGGATGAGGG + Intergenic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1119080479 14:71688647-71688669 GGGGAGAGTCAGATGGATGAGGG - Intronic
1119336128 14:73835323-73835345 ATGGGGGCTCAGATGTATTAGGG + Intergenic
1119557959 14:75567848-75567870 GTGGAGACTCTGGTGGGTGAGGG + Intergenic
1119639212 14:76302110-76302132 TTGGGGAATGAGATGGATGATGG + Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122059732 14:99128993-99129015 CTGGAGGCTCAGGTGGGTGAAGG + Intergenic
1122252798 14:100452003-100452025 ATGGATAGTTGGATGGATGATGG - Intronic
1122328350 14:100896383-100896405 ATGGAGACTGAGCAGGACGAGGG + Intergenic
1123204748 14:106701480-106701502 ATTGATGCTCTGATGGATGAAGG - Intergenic
1123209750 14:106747920-106747942 ATTGATGCTCTGATGGATGAAGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126716468 15:51523630-51523652 AGAGACACTCAGATGGACGAAGG + Intronic
1127155324 15:56118369-56118391 ATGGAGATACAGTAGGATGATGG - Intronic
1127372690 15:58355751-58355773 ATGTTGAGTCAGAGGGATGATGG - Intronic
1128885585 15:71283891-71283913 ATGGAGACTCTGGTGGGGGAGGG + Intronic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130274505 15:82469427-82469449 ATGCAGACCCAGCTGGATGGTGG + Intergenic
1130466853 15:84196801-84196823 ATGCAGACCCAGCTGGATGGTGG + Intergenic
1130497411 15:84476735-84476757 ATGCAGACCCAGCTGGATGGTGG - Intergenic
1130589147 15:85201394-85201416 ATGCAGACCCAGCTGGATGGTGG + Intergenic
1130712278 15:86294911-86294933 ATGGAGACTCGGAAGGGTCAGGG - Intronic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131307693 15:91259761-91259783 ATGGAGACACAGAGGCATCAGGG - Intronic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132793413 16:1706343-1706365 ATGGAGATCCAGATGGACGAGGG + Exonic
1132828145 16:1915026-1915048 AGGGAGGCTGAGATGGAGGAGGG - Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1134515888 16:14886587-14886609 ATGGAGTCTCAGATGACAGAGGG + Intronic
1134703561 16:16285231-16285253 ATGGAGTCTCAGATGACAGAGGG + Intronic
1134963982 16:18426883-18426905 ATGGAGTCTCAGATGACAGAGGG - Intronic
1134968269 16:18509419-18509441 ATGGAGTCTCAGATGACAGAGGG - Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135904166 16:26495500-26495522 ACAGAGACTCAGAAGGGTGAAGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136230211 16:28881228-28881250 ACTGAGGCTCAGAGGGATGAAGG - Intronic
1137915614 16:52426744-52426766 GTGGAGACTGGGATGGATGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138649280 16:58449653-58449675 ATGAAGAATGAGATGGAAGAAGG + Intergenic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138741742 16:59318603-59318625 ATGGAGATTCTGAAGGGTGAGGG - Intergenic
1138969484 16:62127598-62127620 ATAGTGACTCACATTGATGAGGG + Intergenic
1139232953 16:65304239-65304261 TTGGAGTCTTAGATGGAAGAGGG + Intergenic
1139500534 16:67360712-67360734 TTAGAGCCTCAGATGGATGGAGG + Intronic
1139559728 16:67734434-67734456 AATGAGACTCAGTTGGATGCTGG + Intronic
1139568643 16:67796439-67796461 ATAGAGGCCCAGATGGTTGAGGG - Intronic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141055046 16:80805718-80805740 ATGGAGAGTGAGATGGCAGAGGG + Intergenic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141404355 16:83778792-83778814 AAAGAGTCTCAGATGGCTGATGG - Intronic
1141515235 16:84539704-84539726 AGGGAGACTCGGGAGGATGAGGG + Intronic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141866448 16:86753142-86753164 ATGGAGACCCAGCTTGCTGAGGG + Intergenic
1142262022 16:89047503-89047525 ACGGCCACACAGATGGATGATGG + Intergenic
1144089187 17:11838565-11838587 GTGAAGACCCAGATGAATGAAGG + Intronic
1144233613 17:13234495-13234517 ATGGAGAATCAAATCGATAAGGG - Intergenic
1144500712 17:15784799-15784821 ATGGAGGCTGTGATTGATGAAGG + Intergenic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1147589180 17:41670387-41670409 ACTGAGAATCAGATGGGTGAAGG + Intergenic
1147904616 17:43814613-43814635 ATTGAGGCTCAGAGAGATGAAGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148427906 17:47616148-47616170 ACTGAGACCCAGAGGGATGAAGG + Intronic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1150433772 17:65139023-65139045 AGGGAGACTAAGGTGGAGGAGGG - Intronic
1152334570 17:79693173-79693195 ATGGAGACTCTGAATGATGGTGG + Intergenic
1152742679 17:82025206-82025228 AGGCAGCCTCAGAGGGATGAGGG - Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1154439870 18:14379936-14379958 ATGGATAGTTAGATGGATAAGGG - Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156895193 18:42238299-42238321 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
1157569901 18:48705348-48705370 GAGGAGACACAGAGGGATGAAGG - Intronic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1159372548 18:67546852-67546874 ATGGAGACTTTGAGGGACGATGG - Intergenic
1159637768 18:70826221-70826243 ATAGTTACTCAGATGGAGGATGG - Intergenic
1159768984 18:72526662-72526684 TTGGAGACTCAGATGCAGGGAGG - Intergenic
1162311542 19:9910609-9910631 ATGGAGAGGCAGATGGATGGTGG + Intronic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165258148 19:34592402-34592424 AGGGAGACTCAGAGGGATGGAGG + Intergenic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1165786148 19:38463240-38463262 GTTGACACTCAGATGGGTGAGGG - Intronic
1166207366 19:41280199-41280221 ATGGAGACTCAGAAGTGTTAGGG + Intronic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168190339 19:54733823-54733845 ATGGAGATACAGATAGATCATGG + Intronic
1168360118 19:55732484-55732506 TTGGATACACAGATGCATGAAGG + Exonic
1168379005 19:55904440-55904462 ATAGAGACTCAGATGAAGCAAGG - Intronic
1168393267 19:56027975-56027997 CTGGAGACTGAGGTGGAAGAAGG - Exonic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
1168555944 19:57339985-57340007 ATGTAGACACAAATGGATTAGGG + Intergenic
925745340 2:7039047-7039069 ATGGAGAGAGAGATGTATGATGG + Intronic
925745358 2:7039144-7039166 ATGGATAGAGAGATGGATGATGG + Intronic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927554200 2:24021204-24021226 ATGGTGACTCAGATTAATGGAGG - Intronic
928276194 2:29902371-29902393 ATGCAGATTCAGCAGGATGATGG - Intronic
928954207 2:36844755-36844777 ATGAAGATCCAGTTGGATGATGG + Exonic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
932089503 2:68792413-68792435 ACAGAAACTCAGAAGGATGAGGG - Intronic
932489366 2:72110262-72110284 CTGGAGAGTTAGTTGGATGATGG - Intergenic
932796342 2:74699349-74699371 GAGGTGACTCAGATGGATTATGG - Intergenic
932815725 2:74860151-74860173 ATGGAGACTTGGAAGGGTGAGGG + Intronic
932893065 2:75612621-75612643 ATGGGGAGCCAGATGGGTGAGGG - Intergenic
933352742 2:81176304-81176326 ATGGAGACTCAAAGGTGTGATGG + Intergenic
933458335 2:82545669-82545691 ATGGAGACTAAGAAGGGTGGAGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
935023299 2:99252577-99252599 ATGGATAGTTGGATGGATGAAGG + Intronic
935511667 2:103983800-103983822 ATGGCTGCTCACATGGATGAGGG - Intergenic
935555843 2:104508744-104508766 ATGGGGACCCACATGGAGGAAGG + Intergenic
935702535 2:105824925-105824947 ATTGAGACTCAGGTGGGAGATGG - Intronic
935827475 2:106965728-106965750 ATGGAGATTCTGCTGGAGGAGGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939939979 2:148337586-148337608 ATGAAGAGACAGATGGCTGAGGG + Intronic
940465209 2:154018808-154018830 AAGGAGAGTGAGATGGAAGATGG + Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
942841465 2:180366818-180366840 ATGGAGACTCAGCTGAATGTTGG + Intergenic
943924284 2:193752004-193752026 ATGAAAACTCAGAAGGGTGAGGG - Intergenic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945374505 2:209063776-209063798 ATGGAGAATCTGATGAATGCAGG - Intergenic
946109672 2:217403543-217403565 AGAGAGACTCAGTTGGAGGAGGG - Intronic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948458489 2:238118210-238118232 ATGGAGCAGCAGATGGATGGAGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169292283 20:4362982-4363004 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1169938826 20:10915092-10915114 ATGGAGACTTGGAAGGGTGAGGG + Intergenic
1170043197 20:12059861-12059883 ATGGAGACTGAGATAGCTCAAGG - Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171820265 20:29829893-29829915 AAGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1172780795 20:37436085-37436107 ATGGGGACATGGATGGATGATGG - Intergenic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1173539802 20:43842867-43842889 ATGGAGCCTCAAATGTCTGAGGG + Intergenic
1173871527 20:46345034-46345056 ATGGAGGGGTAGATGGATGAAGG - Intergenic
1174284894 20:49465514-49465536 ATGGAAACTCAGAGAGAAGAAGG + Intronic
1174407337 20:50310765-50310787 ACGGAGGCTGAGATGGCTGACGG + Intergenic
1174746952 20:53072954-53072976 ATGGAGGGATAGATGGATGAAGG - Intronic
1174747007 20:53073165-53073187 ATGGAGGGATAGATGGATGAAGG - Intronic
1174821191 20:53727809-53727831 CTGGGGGCTCAGATGGGTGAGGG - Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175750333 20:61492591-61492613 ATGAAGACTCAGATAGATGGTGG + Intronic
1175762831 20:61572889-61572911 ATGGACAGACGGATGGATGATGG + Intronic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175774366 20:61643800-61643822 AGGGGAACTCAGATGGATTAAGG - Intronic
1175802686 20:61810166-61810188 ACGGAGACAGAGATGGGTGAGGG + Intronic
1175817253 20:61889719-61889741 ATGGACAGACAGATGGATGATGG + Intronic
1176455875 21:6909835-6909857 ATGGATAGTTAGATGGATAAGGG + Intergenic
1176834049 21:13774883-13774905 ATGGATAGTTAGATGGATAAGGG + Intergenic
1177112192 21:17042023-17042045 ATGGAGGCTCAGAAGGATTGGGG + Intergenic
1178005140 21:28210365-28210387 GAGGAGAACCAGATGGATGATGG - Intergenic
1178434745 21:32548083-32548105 ATGGAGATTTGGAAGGATGAGGG - Intergenic
1179057999 21:37953847-37953869 ATGGAGACACAGAGAGCTGAAGG + Intronic
1179464812 21:41564546-41564568 ACTGAGACTCAGAGAGATGAAGG - Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180390611 22:12278697-12278719 ATGGAGATTCACATGTAAGAGGG + Intergenic
1180409132 22:12586060-12586082 ATGGAGATTCACATGTAAGAGGG - Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1180926796 22:19560774-19560796 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1182347826 22:29679208-29679230 CTGCAGAGTCAGATGGGTGAGGG - Intronic
1182859963 22:33551033-33551055 ATGGAAACTCAGAAGGGTAAAGG + Intronic
1183677278 22:39306661-39306683 ATGGTGTCACAGATGGATGGGGG + Intergenic
1183709740 22:39495864-39495886 GTGGACACTCATGTGGATGAGGG - Intergenic
1184003850 22:41694655-41694677 GTGGAAATTCAGATGGAAGAGGG + Exonic
1184117340 22:42429923-42429945 ATGGAGTGACAGATAGATGAAGG + Intronic
1184235700 22:43181981-43182003 GGGGAGACTCAGGGGGATGAAGG + Intronic
1184910966 22:47533871-47533893 ATGGGGACTCAGTGGGACGAAGG + Intergenic
949160998 3:881790-881812 ATGGAGACCCACAAGGGTGAGGG - Intergenic
949456837 3:4247911-4247933 ATTGAGACTCAGAGAGATCAAGG - Intronic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
949937416 3:9126758-9126780 ACAGAGACTCAGAAGGGTGAGGG + Intronic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
951397845 3:22192040-22192062 ATGGAGAAAGAGATGAATGATGG - Intronic
951706747 3:25551470-25551492 ATGGGCCCTCAGATGGATTATGG + Intronic
951845534 3:27080567-27080589 GTGGAGACTGAGGTGAATGAAGG - Intergenic
952123536 3:30273397-30273419 ATGGAGACTGGGAGGGTTGAGGG - Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952656453 3:35792272-35792294 GTGGAGACTGAGATGTCTGAAGG + Intronic
952899868 3:38103144-38103166 ACGGAGACTCGGAAGGGTGAGGG - Intronic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953804287 3:46054529-46054551 ATGGACACTCAAAAGGACGAGGG + Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
957086661 3:75685952-75685974 ATGGAGACACAGCAGGGTGAGGG - Intergenic
957663255 3:83188486-83188508 GTGGAGATGCACATGGATGAGGG + Intergenic
957771681 3:84701413-84701435 ATGAAGACTCAGAAGGGTGTGGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958580270 3:96009209-96009231 ATAGAGACTTAGAAGTATGAGGG + Intergenic
959224786 3:103565835-103565857 AAGGAGACTAAGATGGAGAATGG + Intergenic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
959641752 3:108646109-108646131 ATGGAGATTTAGTGGGATGATGG - Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960412560 3:117345769-117345791 AGGGAAACTCAAAAGGATGATGG - Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961315653 3:126033595-126033617 GTGAAGACTCACCTGGATGAGGG + Exonic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
963704353 3:148666985-148667007 ATGGATAGTTGGATGGATGAAGG + Intergenic
964629423 3:158794085-158794107 GTAGAGACTCAGAAGGGTGAAGG - Intronic
966369283 3:179230980-179231002 ACAGAGACTCAGATGGGAGACGG - Intronic
967940934 3:194766063-194766085 TTGGAGACTCAGATGCAGGGAGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
969571584 4:8012087-8012109 ATGGATGGGCAGATGGATGATGG - Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970234846 4:13948133-13948155 ACTGAGACTCAGAGGGATAAAGG - Intergenic
970497914 4:16645807-16645829 ATTGAGACTTAGAAAGATGAAGG - Intronic
971041032 4:22752439-22752461 CTAGGGAGTCAGATGGATGATGG + Intergenic
971424489 4:26502720-26502742 CTGGAAACGCAGAGGGATGAAGG - Intergenic
971524119 4:27594422-27594444 ATGGAAACTGAGATGGATATGGG - Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972351936 4:38244187-38244209 ATGGAAACACAGCAGGATGAAGG - Intergenic
972456087 4:39256797-39256819 ATGGAGAACAGGATGGATGAAGG - Intronic
973019959 4:45190740-45190762 ATGGAGACTCTGATTGCTAAAGG + Intergenic
973156296 4:46957671-46957693 ATGGAGGCTGAGATAGATGGTGG - Intronic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974629623 4:64468310-64468332 ATGGCAACTCAGTTGAATGAGGG - Intergenic
975802647 4:78077597-78077619 ATGGAGACTCGGAAGGGTGTGGG - Intronic
977249728 4:94676380-94676402 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
977306593 4:95330971-95330993 ACAGAGACTCAGAAGGATGCAGG - Intronic
977665827 4:99646414-99646436 ATGGAAACACAGATGGTTAATGG + Intronic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
978383564 4:108156838-108156860 GTAGAGACTCAGAAGGGTGAGGG + Intronic
978994061 4:115128116-115128138 ATGGTGACTCAGAAGGGTTAGGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979578412 4:122323875-122323897 TTGGAGTCTAAGATGGATAATGG - Intronic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980979734 4:139644024-139644046 ATGGAGACTTGGATGGGTGGGGG - Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
982873458 4:160613761-160613783 ATGGATACTGAGAATGATGAGGG - Intergenic
983506969 4:168564016-168564038 ATGGAGACTGGGAAGGGTGAAGG - Intronic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
985328987 4:188806178-188806200 ATGGAGTCTCAGATGAATCCCGG + Intergenic
986351702 5:6886182-6886204 ATGGAGACTCAGGGGGTTGGGGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987014669 5:13805800-13805822 ATGGAAACTGAGAGGGCTGAGGG + Intronic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988433064 5:31142230-31142252 ATGGAGGCCCTGATGGATAAAGG - Intergenic
988490455 5:31701056-31701078 ATGGAGACTCAGGTGTCAGACGG - Intronic
989439662 5:41455440-41455462 ATGCTGTCTCAGAGGGATGATGG + Intronic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
990494108 5:56329553-56329575 ATGGAAAGCCAGATGGCTGAAGG - Intergenic
990979296 5:61587340-61587362 TTGGTGACTCAGATGCAAGACGG + Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994493835 5:100484566-100484588 ATGGATAGTCAGATAGAAGATGG - Intergenic
995469968 5:112490955-112490977 ATAGAGACACAGAGGGAGGAAGG + Intergenic
997375148 5:133392368-133392390 ACGGAGAGTCAGAGGGATGGGGG + Intronic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
998934058 5:147215760-147215782 ATTGAGACTCAGGAGCATGAAGG - Intergenic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
1000181966 5:158820279-158820301 GCGGAGACACAGAGGGATGAGGG + Intronic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1001111563 5:168900937-168900959 ATGGAGCCTCAGAAGCGTGAGGG + Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001411086 5:171512456-171512478 ATGGAGGCTCAGAGAAATGAAGG - Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1001916843 5:175569029-175569051 ATGGTGATACAGCTGGATGAGGG + Intergenic
1003009250 6:2410797-2410819 ATAAAGACTCAGATGCTTGATGG + Intergenic
1003451773 6:6241196-6241218 ATGGAGACTCAAGTCCATGATGG + Intronic
1003665941 6:8111443-8111465 ATGAAGTCCCAGATGTATGATGG - Intergenic
1004478836 6:15999820-15999842 ACTGAGACTCAGAAGGATAAAGG + Intergenic
1004675572 6:17838760-17838782 ATGGAGACTTGGAAGGGTGAGGG + Intronic
1005285184 6:24318558-24318580 TTAGAGACTCAGAAGGATGCTGG - Intronic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1005422816 6:25670484-25670506 TTGGAGAGTCAGATAGATGAAGG + Intronic
1005454224 6:26003653-26003675 CTGGAAACTCAGAGAGATGATGG + Intergenic
1005849507 6:29810917-29810939 ATGGAGACCCAGAAGGGTAAGGG + Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1007350064 6:41265870-41265892 ATAGAGACTCAGAAGAGTGAGGG + Intergenic
1008117523 6:47569240-47569262 ATGGAAACTCAGAAGAATGGTGG + Intronic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009346814 6:62623333-62623355 ATGGAGAGTCAAATGTATGTTGG + Intergenic
1010277758 6:73989651-73989673 ACAGAGACTCAAAGGGATGAGGG + Intergenic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1010828423 6:80501167-80501189 ATAGAGACTCCGAAGGATGAGGG + Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1011727673 6:90227079-90227101 ATGGCAAATCAAATGGATGAAGG - Intronic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1012880441 6:104781676-104781698 ATGGAGCCTCAGTGGGATGCAGG - Intronic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1015299637 6:131638192-131638214 ATGAACACTCAAGTGGATGAAGG - Intronic
1015365920 6:132398052-132398074 ATAGAGACTCAAAAGGGTGAAGG - Intronic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015784391 6:136906069-136906091 ATGGAGAATCAATGGGATGATGG - Intronic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016563483 6:145424260-145424282 ATAGAGAAACAGCTGGATGAGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017616578 6:156252583-156252605 ATGGAGATTTGGAAGGATGAGGG - Intergenic
1018573202 6:165232236-165232258 CTGGAGACTGAGATGAAAGAGGG - Intergenic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019777421 7:2920558-2920580 ATGGATACGTAGATGGATGATGG - Intronic
1020030442 7:4929163-4929185 ATGGAGTCCCAGCTGGATGCAGG - Intronic
1020152597 7:5695046-5695068 ATGGGGACACAGATGGGTTAGGG + Intronic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021416529 7:20392681-20392703 ATGGAGACTTGGAAGGGTGAGGG - Intronic
1021939999 7:25669682-25669704 ATGGAGACTCGGGTGGGGGAAGG + Intergenic
1024272458 7:47652864-47652886 AGGGAGACTCAGAAGGGTGGAGG + Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609352 7:80340220-80340242 ATGGAGACTATGATGTATGCGGG + Intergenic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1029374688 7:100170586-100170608 AGGGAGACACAGGTGGATGCCGG + Intronic
1029604830 7:101592268-101592290 ATGGATACCTAGATGGGTGAGGG - Intergenic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031500830 7:122513778-122513800 ATGGAGACTGAGATTGGTGCAGG - Intronic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031808330 7:126334696-126334718 CTTGAGACTGACATGGATGAGGG - Intergenic
1033345341 7:140521896-140521918 ATGGAGACTCAGATGTTTCGGGG - Exonic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1034877131 7:154734465-154734487 ATGGTCACTAAGATGTATGACGG - Intronic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038907606 8:31923866-31923888 ATGGAGACTTAGAGGGGTGAGGG - Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1039004969 8:33025864-33025886 TTGGGGATTCAGATGGATAAAGG - Intergenic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039595624 8:38787784-38787806 AGGGAGTCGCAGATGGATGGAGG - Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040893670 8:52342962-52342984 AGGGAGAGACATATGGATGAGGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043196304 8:77296478-77296500 TTGGAGACACAGCTGAATGATGG + Intergenic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045090187 8:98733982-98734004 ATGGAGACTCACAATCATGACGG + Intronic
1045937686 8:107700413-107700435 ATGGATCAACAGATGGATGATGG + Intergenic
1046118299 8:109811713-109811735 ATGCAGACTCACATGGGAGAAGG + Intergenic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1046693298 8:117310259-117310281 ATGTAGACTCAGATGGCTACAGG + Intergenic
1047102531 8:121694111-121694133 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047217300 8:122886935-122886957 ATGGAGGCTCAGATAGGTTAAGG + Intronic
1047834073 8:128669191-128669213 ATTGAGACTCACATTGATGATGG + Intergenic
1048069293 8:131004836-131004858 ATGGACACTCACAGGGTTGAAGG + Intronic
1048200621 8:132371169-132371191 AAGGAGAGTCAGATTGAAGATGG - Intronic
1048714330 8:137251155-137251177 AGGGAGACTCAGAAGGGTGCAGG + Intergenic
1050286520 9:4108401-4108423 ATGGAAACTCTGAGGGAAGAAGG + Intronic
1050475621 9:6037824-6037846 TTGGAGACTCAGAAGAATGTAGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054880347 9:70138061-70138083 GTGGAGACTTAGAAGGGTGAGGG - Intronic
1054942884 9:70763141-70763163 AAGGTCACTCAGCTGGATGAAGG + Intronic
1056240054 9:84636268-84636290 ATGATAACTCAGATGTATGAGGG + Intergenic
1057519736 9:95751642-95751664 ATGGAGCCTGAGCTGCATGAGGG + Intergenic
1058386470 9:104442401-104442423 ATGTAGGCTCTCATGGATGAAGG - Intergenic
1058404869 9:104661433-104661455 ATGGAGCCTCACATGAAGGAAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058823441 9:108753837-108753859 ATGGACCCTGGGATGGATGATGG - Intergenic
1058823463 9:108753973-108753995 ATGGACACTGGGATGGATGATGG - Intergenic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059643904 9:116245144-116245166 ATGGACACTCAGAAGGGTGGGGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1059990082 9:119856775-119856797 ATGGAGACTGGGAAGGGTGAAGG - Intergenic
1060584599 9:124777956-124777978 ACGGAGGCTCAGATGGGCGATGG - Intronic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1062268469 9:135698210-135698232 GTGGAGACCCAGAGGGCTGAAGG + Intronic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1203375609 Un_KI270442v1:373678-373700 ATGGAGACTCGGCAGGGTGAGGG + Intergenic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187190278 X:17028045-17028067 ATGAAGACTCAGCTGCATGGGGG - Intronic
1187298620 X:18026843-18026865 ATAAAAACTCACATGGATGAAGG - Intergenic
1187834710 X:23420146-23420168 GTGGAGACTCAGAAGTATGGGGG + Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188181439 X:27060815-27060837 ATGGAGGCTCAGAAGGGTGGAGG - Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1189129401 X:38482416-38482438 ATGGAGACTCAGAGGAATGCTGG - Intronic
1189175570 X:38953866-38953888 ATGGAGGCTCAGAAGGATCAAGG + Intergenic
1189494377 X:41495827-41495849 ATGGAAATTCAGAAGGGTGAGGG - Intergenic
1189719362 X:43899602-43899624 GAAGAGACTGAGATGGATGAGGG + Intergenic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190248135 X:48704326-48704348 ATGGAGACTAGGAAGGATGTGGG + Intronic
1190681409 X:52830047-52830069 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1190998502 X:55636087-55636109 AGGGAGACTCAGAGGGAGAAGGG - Intergenic
1191803483 X:65107006-65107028 ATGGATACTCACATGAATGTAGG + Intergenic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192360576 X:70436289-70436311 CTGGAGACTCGGGTCGATGAAGG - Intergenic
1193218303 X:78891576-78891598 ATGGAGACTTAGAATGATAAGGG + Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193525852 X:82587911-82587933 ATGGAGACTCAGACAGGTGGAGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194710772 X:97233999-97234021 AAGGAGACTCAGTTGCATTATGG + Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199336825 X:146628354-146628376 CTGGAGACTGGGATGGATGTGGG - Intergenic
1199661336 X:150053710-150053732 AAGGAGAATGAGAGGGATGATGG - Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1202267248 Y:23033222-23033244 AGGGATACTCTGAAGGATGAAGG + Intergenic
1202420240 Y:24666966-24666988 AGGGATACTCTGAAGGATGAAGG + Intergenic
1202450546 Y:25003116-25003138 AGGGATACTCTGAAGGATGAAGG - Intergenic