ID: 1020970470

View in Genome Browser
Species Human (GRCh38)
Location 7:14931673-14931695
Sequence GGTCTGAGAGGAATCCATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020970470 Original CRISPR GGTCTGAGAGGAATCCATGT TGG (reversed) Intronic
903974884 1:27142927-27142949 GGTCTGGGATGAATCCTTGGAGG - Intronic
906098921 1:43243502-43243524 GCTCTTTGAGGAATCCATGAGGG + Intronic
907608549 1:55844220-55844242 AGTCTGATAGAAACCCATGTGGG + Intergenic
907873801 1:58466465-58466487 GGTCTGTGTGGAAGCAATGTGGG + Intronic
910320356 1:85936713-85936735 GGTATTAGAGGAATCAATGGTGG + Intronic
910551742 1:88482982-88483004 GGTATGAGAGAAAGACATGTGGG - Intergenic
910654494 1:89605972-89605994 GGGCTGGCAGGAATGCATGTGGG - Intergenic
911295136 1:96105992-96106014 GGTCTGCCAGGAATTCATTTTGG - Intergenic
915135871 1:153731087-153731109 GGTCTGATAGGAAAACAGGTTGG + Intronic
915698953 1:157772486-157772508 GCTCTGAGAGGAATCCACTGGGG + Intronic
915810123 1:158900263-158900285 GGGATGAGAGGAATTCATGTAGG + Intergenic
915812004 1:158923072-158923094 GGTCTGAGAAGCATTCAAGTGGG + Intergenic
916505479 1:165424782-165424804 GGTCTGAGAGGGATTCATGATGG - Intronic
917045327 1:170853207-170853229 GGTCTGAGAGGATTCAAGGTGGG + Intergenic
917429022 1:174946249-174946271 GGTTTGAGAGCTATGCATGTTGG + Intronic
919298555 1:195733064-195733086 TGTCTGAGAGGAATCATTTTGGG - Intergenic
919779204 1:201211768-201211790 GTTCTGGGAGGAATCCATTAGGG + Exonic
923325711 1:232878418-232878440 GGTGTGAGAGGAGTCCGGGTAGG - Intergenic
1063174487 10:3539387-3539409 AGTGTCAGAGGAGTCCATGTGGG - Intergenic
1074489857 10:113929905-113929927 GGCCAGAGAGGAATCCATTTAGG + Intergenic
1075895216 10:125989182-125989204 GGGCTCAGAGGTCTCCATGTGGG - Intronic
1077238922 11:1500596-1500618 GGTCTGAGAGGGGTCCAGGGAGG - Intronic
1077725484 11:4671087-4671109 GGTGTCAGTGGAAACCATGTGGG - Intergenic
1078083391 11:8219488-8219510 GGTCTGACTGGAGTCCATGCAGG - Intergenic
1078975366 11:16468590-16468612 GGTGTGAGGTGGATCCATGTTGG - Intronic
1079181248 11:18195436-18195458 TGTGTGAGAGGAGTCTATGTTGG - Intronic
1079268403 11:18958115-18958137 TGTGTGAGAGGAGTCCATGAGGG + Intergenic
1081651754 11:44828536-44828558 GGTCTGAGCTGAATGCATGAAGG + Intronic
1084356371 11:68641417-68641439 CGGCAGAGAGGAATACATGTGGG + Intergenic
1087593430 11:100222011-100222033 GTAATGAGAGGAATTCATGTGGG - Intronic
1089678220 11:120104807-120104829 GCTCACAGAGGAATCCAAGTGGG - Intergenic
1090278054 11:125433266-125433288 GGGCTGAGAGGAAGAGATGTGGG - Exonic
1090626168 11:128610893-128610915 GGTCTGAGAGGAAGGCCTGATGG - Intergenic
1091201442 11:133783928-133783950 CATCTGAGAGGGATGCATGTGGG - Intergenic
1091596163 12:1880431-1880453 GCTGTGAGTGGAGTCCATGTGGG - Intronic
1091885248 12:4012484-4012506 GATCTGAGTGGAATTCAGGTGGG - Intergenic
1093874961 12:24339475-24339497 GGTCACAGAGGAAGCCAGGTAGG + Intergenic
1094067696 12:26378862-26378884 GGCCTGAGAGGAATTCAAATAGG - Intronic
1098921149 12:76303366-76303388 GGACTTAAAGGAATGCATGTAGG - Intergenic
1104431621 12:128721021-128721043 CGGCTGAGAGGATTCCATGGAGG - Intergenic
1106355710 13:28981243-28981265 TGTTTGAGATTAATCCATGTGGG - Intronic
1110426020 13:75368417-75368439 GGTCTGAGAGGAAACTGTCTTGG - Intronic
1110934664 13:81272222-81272244 GGTCTGAGAGGAATTTGTATGGG - Intergenic
1111455644 13:88480328-88480350 GGTGTGATAGGAATCCAAGAAGG - Intergenic
1118418830 14:65576306-65576328 GGTCAGAGAGTAAACTATGTAGG - Intronic
1125521276 15:40349066-40349088 GGGCTGAGAGGAATGCATGGGGG - Intergenic
1126428045 15:48550596-48550618 GGCCAGAGAGGAAGCCAAGTAGG - Intronic
1126466262 15:48963767-48963789 GCTCCGAGAGGAATCCAGGAGGG - Intergenic
1130852040 15:87804169-87804191 GATCTGTGGGGAATCCATGAAGG + Intergenic
1135643654 16:24142777-24142799 GGACTGGGAAGAATCCATGCAGG + Intronic
1136615040 16:31393430-31393452 GTTCTGAGGGGACTCCATCTGGG + Intronic
1143299522 17:5899346-5899368 GGTGTGAGAGGAATGCGTTTGGG + Intronic
1144762523 17:17715422-17715444 TGGCTGAGAGGATTCCATGTGGG + Intronic
1146073877 17:29709811-29709833 TGTCTGAGATGAATCCAGCTGGG + Intronic
1149395734 17:56240682-56240704 GGTCTGAAAATAACCCATGTTGG - Intronic
1149696628 17:58621418-58621440 GGTGTGAGAGGAATGAGTGTGGG - Intronic
1151308276 17:73277906-73277928 AGTCTGAGAGGAATTCTCGTGGG - Intergenic
1153918992 18:9771744-9771766 GGTCAGAGAGGATTCGATGGTGG + Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1167575431 19:50315456-50315478 GGGCTGGGTGGAATGCATGTGGG + Intronic
925104993 2:1283359-1283381 GGGCTGAGAAGCCTCCATGTTGG - Intronic
925796499 2:7550575-7550597 ACTCAGAGAGGAATCCATGAAGG + Intergenic
926754556 2:16224870-16224892 GTTCTGAGAGGAATGCACCTGGG + Intergenic
927326293 2:21809626-21809648 GGTCTGAGAGGAAGGCAGTTTGG - Intergenic
928029738 2:27768179-27768201 GCTCTGAGAGGAATCTGTGGAGG + Intergenic
930144450 2:47987054-47987076 GGTTGGAGAGGAAGCCAAGTAGG + Intergenic
931133848 2:59374132-59374154 TGTGTGAGTGGAAGCCATGTGGG + Intergenic
935577854 2:104729396-104729418 GGTGTGAGAGGAATCTTTCTTGG + Intergenic
940201203 2:151152854-151152876 GGTGAGGGAGGAAGCCATGTAGG - Intergenic
940280281 2:151981481-151981503 GGTCTGAGCGGAACTCCTGTCGG + Intronic
942512646 2:176718578-176718600 GGACTCAGAGGAATCCAGTTGGG - Intergenic
946984778 2:225258779-225258801 GGTCTGGGAGAAATCCCTGAAGG + Intergenic
947034613 2:225837981-225838003 GAGGTGAGAGGAATCCATCTGGG + Intergenic
1169027881 20:2385402-2385424 GGGCTGAGAGGAGTCCTTGGGGG + Intronic
1170515992 20:17130881-17130903 GGTCTGTCAGGACTCCATGCAGG - Intergenic
1170848241 20:19980602-19980624 GGTAAAAGAGGAATTCATGTAGG + Intronic
1174021525 20:47533985-47534007 GCTGTTAGAGTAATCCATGTTGG + Intronic
1180076407 21:45465597-45465619 GGGCTGAGAGCACTCCATGTGGG + Intronic
1181820082 22:25468717-25468739 GCTCTGCGAGGAATCCAGGCTGG + Intergenic
1182148791 22:28014163-28014185 TGTCTAAGAGGGATACATGTGGG + Intronic
1182612435 22:31560138-31560160 GGTCTAAGAGAAATCTTTGTAGG + Intronic
949147917 3:725877-725899 GGGCTGAGATGAAACCCTGTGGG + Intergenic
949535222 3:4989903-4989925 GGTCTCAGGGGAATCCAAGCAGG + Intergenic
949656492 3:6226794-6226816 GGCTTGAGAAAAATCCATGTTGG - Intergenic
951759649 3:26131560-26131582 TGTCTGGGAGGAATATATGTTGG - Intergenic
951799261 3:26576843-26576865 TTTATGAGAGCAATCCATGTTGG - Intergenic
953608729 3:44429380-44429402 GGCCTGTGAGGACCCCATGTGGG - Intergenic
955564169 3:60226089-60226111 GGTCTCAGGGGAATCCATTTGGG + Intronic
958106930 3:89086946-89086968 TGTCTGAGAGGTTTCCATTTTGG + Intergenic
958987452 3:100798927-100798949 AGTCTGAGAGGAAGCCCCGTTGG + Intronic
960481807 3:118200664-118200686 GTTCTGAGAAGAATCCATTTGGG + Intergenic
962302379 3:134253715-134253737 GGTAAGAGATGAAGCCATGTGGG - Intergenic
964913476 3:161810982-161811004 TGTCTAAGAGGAATTCATATGGG - Intergenic
964989935 3:162797448-162797470 GGCAGGAGAGGAAGCCATGTGGG + Intergenic
965570226 3:170165041-170165063 GGTCTCAGTGGAGACCATGTGGG + Intronic
966460791 3:180174107-180174129 GCTATTAGAGGAATCCAGGTAGG + Intergenic
968750334 4:2385658-2385680 GGGCTGGAGGGAATCCATGTAGG - Intronic
969583167 4:8077168-8077190 GGTCTGGGAGGTAGTCATGTGGG - Intronic
969974698 4:11086657-11086679 GGTATGACAAGAATCCATGCTGG + Intergenic
974211910 4:58788847-58788869 GGTAGGAAAGAAATCCATGTTGG - Intergenic
975273984 4:72473664-72473686 GGTGTGAGAGAAAGCCAAGTGGG + Intronic
980719322 4:136673068-136673090 GGTTTGAGAGGGATACATGAGGG + Intergenic
985717026 5:1468404-1468426 GGGCTGAGTGGGATCCAGGTCGG - Intronic
988873699 5:35419860-35419882 TGTATCAGAGGAATTCATGTGGG + Intergenic
991344866 5:65653654-65653676 AGTCTGAAAGGAATGCAGGTTGG + Intronic
992264998 5:75009708-75009730 AGTGAGAGAGGAAGCCATGTGGG + Intergenic
1000402933 5:160851331-160851353 GGTCTGTGATGAATACATTTAGG - Intronic
1001096948 5:168782691-168782713 GTTCTGAGATGCCTCCATGTGGG + Intronic
1001326886 5:170734930-170734952 GGTGGGAGAGGAATCAAGGTTGG - Intronic
1002136876 5:177113056-177113078 GGTATAAGAGGTATGCATGTGGG - Intergenic
1002359987 5:178662646-178662668 GGTCAGGGAGGTCTCCATGTTGG + Intergenic
1007597448 6:43060154-43060176 GCTCTGAGAGGAATCACCGTAGG - Exonic
1017573304 6:155772020-155772042 GGCCTGAGAAGCAGCCATGTGGG - Intergenic
1018711484 6:166500842-166500864 GGGCTGAGATGAAGCCATGGAGG + Intronic
1020970470 7:14931673-14931695 GGTCTGAGAGGAATCCATGTTGG - Intronic
1022418192 7:30196166-30196188 GGTCTGATAGGAGACCCTGTAGG + Intergenic
1023239996 7:38133803-38133825 GGTATCAGTGGAAACCATGTGGG + Intergenic
1027563767 7:79765433-79765455 GGTCTGAGAGGAATTCAAAATGG - Intergenic
1029899558 7:104024400-104024422 TGTCGGAGAGGAATCCATTGGGG + Intergenic
1032640573 7:133762092-133762114 GCTCTGAGTGGAATCCATGATGG + Intronic
1033276349 7:139974398-139974420 GGTCAGAGAGAAGTCCAGGTTGG - Intronic
1033845310 7:145424853-145424875 TTTCTGAGAGGAATCAGTGTAGG - Intergenic
1034563918 7:151898705-151898727 GGTGGGAGAGGAAAGCATGTAGG - Intergenic
1035124818 7:156600962-156600984 GGTCTGAGAGGGAGTGATGTGGG - Intergenic
1035667759 8:1391570-1391592 GCTCTGTGAGGCATCCATGGTGG - Intergenic
1040352038 8:46579015-46579037 GGACTGGAAGGAAGCCATGTGGG + Intergenic
1041776928 8:61533574-61533596 TGTCTGACAGGCCTCCATGTTGG + Intronic
1043952200 8:86321808-86321830 AGTCTGAGAGGCATTCATGTGGG + Intergenic
1048141496 8:131799267-131799289 GGGCTGGGAGGAATCCATCATGG + Intergenic
1049125667 8:140785245-140785267 GGTCTTAGAGGAATGCATTCTGG - Intronic
1049522815 8:143103059-143103081 GGTCTGGGAGGGAACCCTGTGGG - Intergenic
1049995718 9:1032064-1032086 TGTCTCAGAGGGATTCATGTAGG + Intergenic
1051094519 9:13450933-13450955 TGTCTAAGAGGAACCCATGGTGG + Intergenic
1057039766 9:91839636-91839658 GGTGTGAGAGGTATATATGTGGG + Intronic
1061394879 9:130338326-130338348 GGTCAGAGGGGAACCCATGAAGG + Intronic
1062043593 9:134415219-134415241 TGGCTGAGAGGCATCCACGTGGG + Intronic
1062719853 9:138034337-138034359 GGTCTGAGAGAGAGCCAAGTGGG - Intronic
1189501854 X:41568388-41568410 GCTTTCAGAGGAATCCTTGTAGG - Intronic
1193151680 X:78131676-78131698 GTTCTGTGACGAAACCATGTTGG + Exonic
1196595605 X:117542190-117542212 GGTCTGCGAAGAATTCATGAAGG - Intergenic
1197653178 X:129087129-129087151 GGTCTGAGAAATATCCCTGTGGG + Intergenic