ID: 1020973180

View in Genome Browser
Species Human (GRCh38)
Location 7:14972894-14972916
Sequence GTGTATACATACATATAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020973177_1020973180 19 Left 1020973177 7:14972852-14972874 CCACTCTAAACACAAAGCATGTG 0: 1
1: 0
2: 1
3: 14
4: 145
Right 1020973180 7:14972894-14972916 GTGTATACATACATATAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020973180 Original CRISPR GTGTATACATACATATAGGT GGG Intronic
No off target data available for this crispr