ID: 1020975034

View in Genome Browser
Species Human (GRCh38)
Location 7:14995508-14995530
Sequence GTGATAACCTTAAAGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020975034_1020975039 7 Left 1020975034 7:14995508-14995530 CCCTTTTTCTTTAAGGTTATCAC No data
Right 1020975039 7:14995538-14995560 GGGGTGCTTTATCAACTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020975034 Original CRISPR GTGATAACCTTAAAGAAAAA GGG (reversed) Intergenic
No off target data available for this crispr