ID: 1020975096

View in Genome Browser
Species Human (GRCh38)
Location 7:14996202-14996224
Sequence TGCTCTGATTAAGTTATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020975096_1020975099 8 Left 1020975096 7:14996202-14996224 CCTTTTATAACTTAATCAGAGCA No data
Right 1020975099 7:14996233-14996255 CCCCACTCAGCTCTTACAGTGGG No data
1020975096_1020975097 7 Left 1020975096 7:14996202-14996224 CCTTTTATAACTTAATCAGAGCA No data
Right 1020975097 7:14996232-14996254 TCCCCACTCAGCTCTTACAGTGG No data
1020975096_1020975102 30 Left 1020975096 7:14996202-14996224 CCTTTTATAACTTAATCAGAGCA No data
Right 1020975102 7:14996255-14996277 GCCTTCACCTTAATTAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020975096 Original CRISPR TGCTCTGATTAAGTTATAAA AGG (reversed) Intergenic