ID: 1020975098

View in Genome Browser
Species Human (GRCh38)
Location 7:14996233-14996255
Sequence CCCACTGTAAGAGCTGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020975098_1020975102 -1 Left 1020975098 7:14996233-14996255 CCCCACTCAGCTCTTACAGTGGG No data
Right 1020975102 7:14996255-14996277 GCCTTCACCTTAATTAGAGTAGG No data
1020975098_1020975105 19 Left 1020975098 7:14996233-14996255 CCCCACTCAGCTCTTACAGTGGG No data
Right 1020975105 7:14996275-14996297 AGGAGTCAAAGTCCTTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020975098 Original CRISPR CCCACTGTAAGAGCTGAGTG GGG (reversed) Intergenic