ID: 1020975099

View in Genome Browser
Species Human (GRCh38)
Location 7:14996233-14996255
Sequence CCCCACTCAGCTCTTACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020975096_1020975099 8 Left 1020975096 7:14996202-14996224 CCTTTTATAACTTAATCAGAGCA No data
Right 1020975099 7:14996233-14996255 CCCCACTCAGCTCTTACAGTGGG No data
1020975095_1020975099 21 Left 1020975095 7:14996189-14996211 CCATAATAATGATCCTTTTATAA No data
Right 1020975099 7:14996233-14996255 CCCCACTCAGCTCTTACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020975099 Original CRISPR CCCCACTCAGCTCTTACAGT GGG Intergenic