ID: 1020975100

View in Genome Browser
Species Human (GRCh38)
Location 7:14996234-14996256
Sequence GCCCACTGTAAGAGCTGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020975100_1020975105 18 Left 1020975100 7:14996234-14996256 CCCACTCAGCTCTTACAGTGGGC No data
Right 1020975105 7:14996275-14996297 AGGAGTCAAAGTCCTTACCATGG No data
1020975100_1020975102 -2 Left 1020975100 7:14996234-14996256 CCCACTCAGCTCTTACAGTGGGC No data
Right 1020975102 7:14996255-14996277 GCCTTCACCTTAATTAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020975100 Original CRISPR GCCCACTGTAAGAGCTGAGT GGG (reversed) Intergenic