ID: 1020975102

View in Genome Browser
Species Human (GRCh38)
Location 7:14996255-14996277
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020975101_1020975102 -3 Left 1020975101 7:14996235-14996257 CCACTCAGCTCTTACAGTGGGCC No data
Right 1020975102 7:14996255-14996277 GCCTTCACCTTAATTAGAGTAGG No data
1020975098_1020975102 -1 Left 1020975098 7:14996233-14996255 CCCCACTCAGCTCTTACAGTGGG No data
Right 1020975102 7:14996255-14996277 GCCTTCACCTTAATTAGAGTAGG No data
1020975096_1020975102 30 Left 1020975096 7:14996202-14996224 CCTTTTATAACTTAATCAGAGCA No data
Right 1020975102 7:14996255-14996277 GCCTTCACCTTAATTAGAGTAGG No data
1020975100_1020975102 -2 Left 1020975100 7:14996234-14996256 CCCACTCAGCTCTTACAGTGGGC No data
Right 1020975102 7:14996255-14996277 GCCTTCACCTTAATTAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020975102 Original CRISPR GCCTTCACCTTAATTAGAGT AGG Intergenic
No off target data available for this crispr