ID: 1020975105

View in Genome Browser
Species Human (GRCh38)
Location 7:14996275-14996297
Sequence AGGAGTCAAAGTCCTTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020975098_1020975105 19 Left 1020975098 7:14996233-14996255 CCCCACTCAGCTCTTACAGTGGG No data
Right 1020975105 7:14996275-14996297 AGGAGTCAAAGTCCTTACCATGG No data
1020975101_1020975105 17 Left 1020975101 7:14996235-14996257 CCACTCAGCTCTTACAGTGGGCC No data
Right 1020975105 7:14996275-14996297 AGGAGTCAAAGTCCTTACCATGG No data
1020975100_1020975105 18 Left 1020975100 7:14996234-14996256 CCCACTCAGCTCTTACAGTGGGC No data
Right 1020975105 7:14996275-14996297 AGGAGTCAAAGTCCTTACCATGG No data
1020975104_1020975105 -10 Left 1020975104 7:14996262-14996284 CCTTAATTAGAGTAGGAGTCAAA No data
Right 1020975105 7:14996275-14996297 AGGAGTCAAAGTCCTTACCATGG No data
1020975103_1020975105 -4 Left 1020975103 7:14996256-14996278 CCTTCACCTTAATTAGAGTAGGA No data
Right 1020975105 7:14996275-14996297 AGGAGTCAAAGTCCTTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020975105 Original CRISPR AGGAGTCAAAGTCCTTACCA TGG Intergenic