ID: 1020977114

View in Genome Browser
Species Human (GRCh38)
Location 7:15020436-15020458
Sequence ACTGAGCTCCAGGTGACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020977114_1020977118 1 Left 1020977114 7:15020436-15020458 CCTCAAGTCACCTGGAGCTCAGT No data
Right 1020977118 7:15020460-15020482 AGGCCTGTGCCTCTTCCATAGGG No data
1020977114_1020977117 0 Left 1020977114 7:15020436-15020458 CCTCAAGTCACCTGGAGCTCAGT No data
Right 1020977117 7:15020459-15020481 GAGGCCTGTGCCTCTTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020977114 Original CRISPR ACTGAGCTCCAGGTGACTTG AGG (reversed) Intergenic
No off target data available for this crispr