ID: 1020979485

View in Genome Browser
Species Human (GRCh38)
Location 7:15050366-15050388
Sequence CAATTTTTACAGAATTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020979485_1020979489 30 Left 1020979485 7:15050366-15050388 CCTATGGAATTCTGTAAAAATTG No data
Right 1020979489 7:15050419-15050441 CTCCTGAAATGACAAAATCAAGG No data
1020979485_1020979487 -5 Left 1020979485 7:15050366-15050388 CCTATGGAATTCTGTAAAAATTG No data
Right 1020979487 7:15050384-15050406 AATTGCAGCAACTGAAGCATGGG No data
1020979485_1020979486 -6 Left 1020979485 7:15050366-15050388 CCTATGGAATTCTGTAAAAATTG No data
Right 1020979486 7:15050383-15050405 AAATTGCAGCAACTGAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020979485 Original CRISPR CAATTTTTACAGAATTCCAT AGG (reversed) Intergenic
No off target data available for this crispr