ID: 1020989244

View in Genome Browser
Species Human (GRCh38)
Location 7:15176238-15176260
Sequence GGAACAAAGCCCGAAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020989244_1020989247 6 Left 1020989244 7:15176238-15176260 CCTGTTTCTTCGGGCTTTGTTCC No data
Right 1020989247 7:15176267-15176289 CTCCTCTGCATGATGAAGACTGG No data
1020989244_1020989249 17 Left 1020989244 7:15176238-15176260 CCTGTTTCTTCGGGCTTTGTTCC No data
Right 1020989249 7:15176278-15176300 GATGAAGACTGGAATATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020989244 Original CRISPR GGAACAAAGCCCGAAGAAAC AGG (reversed) Intergenic