ID: 1020992406

View in Genome Browser
Species Human (GRCh38)
Location 7:15216282-15216304
Sequence CTGTGGACAAGAACAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 1, 2: 3, 3: 37, 4: 329}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020992406_1020992413 0 Left 1020992406 7:15216282-15216304 CCTGTCTCTGTTCTTGTCCACAG 0: 1
1: 1
2: 3
3: 37
4: 329
Right 1020992413 7:15216305-15216327 AGGGGTTGCCTGCTTTCCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 221
1020992406_1020992416 13 Left 1020992406 7:15216282-15216304 CCTGTCTCTGTTCTTGTCCACAG 0: 1
1: 1
2: 3
3: 37
4: 329
Right 1020992416 7:15216318-15216340 TTTCCTGGGGAATTGTTAATGGG No data
1020992406_1020992415 12 Left 1020992406 7:15216282-15216304 CCTGTCTCTGTTCTTGTCCACAG 0: 1
1: 1
2: 3
3: 37
4: 329
Right 1020992415 7:15216317-15216339 CTTTCCTGGGGAATTGTTAATGG No data
1020992406_1020992411 -2 Left 1020992406 7:15216282-15216304 CCTGTCTCTGTTCTTGTCCACAG 0: 1
1: 1
2: 3
3: 37
4: 329
Right 1020992411 7:15216303-15216325 AGAGGGGTTGCCTGCTTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 176
1020992406_1020992412 -1 Left 1020992406 7:15216282-15216304 CCTGTCTCTGTTCTTGTCCACAG 0: 1
1: 1
2: 3
3: 37
4: 329
Right 1020992412 7:15216304-15216326 GAGGGGTTGCCTGCTTTCCTGGG 0: 1
1: 0
2: 1
3: 38
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020992406 Original CRISPR CTGTGGACAAGAACAGAGAC AGG (reversed) Intronic
901069546 1:6510234-6510256 CTGGCCAGAAGAACAGAGACAGG - Intronic
901377255 1:8848244-8848266 CTGTGGCCAAGCAGAGAGGCAGG + Intergenic
901973959 1:12929870-12929892 CTGTGGAGAAACACAGAGAGAGG + Intronic
902011221 1:13271898-13271920 CTGTGGAGAAACACAGAGAGAGG - Intergenic
902734862 1:18393839-18393861 CTTTGGATAAGCTCAGAGACTGG - Intergenic
903028359 1:20445217-20445239 CTGTGGACAAGATCAGTAAGAGG + Intergenic
907786723 1:57619976-57619998 CTGGTGACAAGAACAACGACTGG + Intronic
908114143 1:60924734-60924756 CTGTGGGGAAGAACAGGAACAGG - Intronic
908409623 1:63849973-63849995 CTCTGGAGAAGAAAAGAGACAGG - Intronic
909934161 1:81531661-81531683 CGGGGGAAAAAAACAGAGACAGG + Intronic
910262550 1:85306264-85306286 CTGTGGTCAGGATCAGAGACAGG - Intergenic
911383900 1:97150331-97150353 CTGTAGCGAAGAAGAGAGACTGG - Intronic
911622015 1:100075564-100075586 TTGTGGACTATATCAGAGACTGG - Intronic
913295139 1:117311946-117311968 CTGAGGAGAAAAACAGAAACTGG + Intergenic
913443668 1:118926509-118926531 CTGTGGACAATAAAAGATACAGG - Exonic
914450403 1:147786578-147786600 CTCTGGACCAGATCAAAGACTGG - Intergenic
914666881 1:149840056-149840078 CTGTGGACATGGACAGGGAACGG + Exonic
914668886 1:149853734-149853756 CTGTGGACATGGACAGGGAACGG - Exonic
914908000 1:151762501-151762523 CTGTCAATTAGAACAGAGACAGG + Intronic
915818150 1:158992247-158992269 CTCTGGCCAAGGCCAGAGACAGG + Intergenic
916390434 1:164324851-164324873 CTGTTGTAAAGACCAGAGACAGG + Intergenic
916988825 1:170220144-170220166 CTGAGGAACAGAACACAGACTGG + Intergenic
917630452 1:176886616-176886638 CTGTGGACAAGAGAAGAAATTGG + Intronic
917681094 1:177368479-177368501 CTTTGGGTAAGAAGAGAGACAGG - Intergenic
919590232 1:199493396-199493418 CTGTTTACAAGAGCAAAGACTGG - Intergenic
920839573 1:209542881-209542903 CTCTGGACAAGCAGAGAGGCAGG + Intergenic
921124239 1:212162698-212162720 CTGTGGTAAAGACCAGAGATGGG - Intergenic
922346015 1:224697131-224697153 ATGTGGAGAAGACCAGAGAAAGG + Intronic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
1067442498 10:46317245-46317267 CAGTGTACAAGAAAACAGACTGG - Intronic
1067732071 10:48819747-48819769 CTGTGGGCATCAGCAGAGACTGG + Intronic
1067878716 10:50025624-50025646 CTGAGGACAAGAAGCGGGACCGG - Intergenic
1067971080 10:50971533-50971555 CTGTGGACATGAGCATTGACAGG - Intergenic
1069403179 10:68071056-68071078 CTGTGGAAGAGAAAAGTGACAGG - Intronic
1070638860 10:78151553-78151575 CAGTGGCCAAGAACTGAGGCTGG + Intergenic
1071082074 10:81824641-81824663 CTGCAGAGAAGACCAGAGACAGG + Intergenic
1072577250 10:96711566-96711588 CTGTTGAAAAGGACAGAGGCAGG + Intronic
1073322851 10:102626135-102626157 CTGGGGACAAGGACAGGGAGGGG + Intronic
1073398629 10:103239000-103239022 CTGTGGACAAGAATGAAGAAAGG + Intergenic
1074453937 10:113581222-113581244 ATATGGACAAGAACAGATATGGG - Intronic
1075969535 10:126640718-126640740 CTCTGGACAAGGAGAGAGATAGG + Intronic
1076550793 10:131277142-131277164 CTGTGAGGAAGAGCAGAGACCGG + Intronic
1076837133 10:133026845-133026867 CGGGGGACAGGAACAGAGCCCGG - Intergenic
1077899340 11:6476898-6476920 CTGTGGCCAGGAAGATAGACAGG + Exonic
1080426567 11:32160160-32160182 CTTTGGTCAAGACCAGAGACAGG + Intergenic
1082872996 11:57960935-57960957 CTGTGGAGAGGAACAGAGACTGG + Intergenic
1084198882 11:67542261-67542283 CTGTGGCCAGGAAAAGGGACTGG + Intergenic
1084369230 11:68728014-68728036 CTGAGGACAGGGAGAGAGACAGG - Intronic
1084405963 11:68973542-68973564 CTGGGGTCCACAACAGAGACAGG + Intergenic
1085046583 11:73357048-73357070 CCGTGAACAGGAAGAGAGACCGG - Exonic
1085119720 11:73959271-73959293 CTGTAGCCCAGAAGAGAGACGGG - Intronic
1086976151 11:93135407-93135429 CTGTGCAAAAGGACAGGGACTGG - Intergenic
1087084128 11:94199277-94199299 CTTTGGTCAAGAACAGGGAGGGG + Intergenic
1087584498 11:100101266-100101288 CAGTGGAAAAGACCAGTGACAGG + Intronic
1087644807 11:100796346-100796368 CTGAGGACAGGAAGAGAGATGGG - Intronic
1089104755 11:115993171-115993193 CATTGGAAAAGAACTGAGACAGG + Intergenic
1090465460 11:126929371-126929393 GTGTGGACAGGAAGAGAGGCAGG + Intronic
1090942315 11:131397775-131397797 CTGGGGACACGTACAAAGACTGG - Intronic
1091110064 11:132957868-132957890 CTGAGGAGAAGGAGAGAGACTGG - Intronic
1091229228 11:133977091-133977113 CTCTGGCCAAGACCAGAGGCAGG + Intergenic
1091613263 12:2029869-2029891 CTGGGCACAAGAGCAGTGACAGG - Intronic
1091715857 12:2775661-2775683 GTGTGCACAAGGACAGAGTCAGG + Intergenic
1092191534 12:6524880-6524902 CTGGGGAAAAGAAAAGAGCCTGG + Intronic
1093342074 12:17989637-17989659 CTGGGGACTAGAACAGAGTAAGG - Intergenic
1094111606 12:26868555-26868577 CTTAGGCCAAGACCAGAGACAGG + Intergenic
1094658076 12:32440510-32440532 ATGTGGCTCAGAACAGAGACAGG - Intronic
1095114670 12:38338190-38338212 CTGTGGATTAGAAGAGAGTCAGG + Intergenic
1097257233 12:57687936-57687958 CAGTCGACAAGAACACACACTGG + Intergenic
1097969644 12:65619280-65619302 GTGTGGGCAACAACAGTGACAGG + Intergenic
1099837964 12:87931744-87931766 CTGTGGAAAAGAACACTTACTGG + Intergenic
1100155886 12:91799854-91799876 TTCTGGATAAGAACAGAGAGAGG - Intergenic
1100484682 12:95013780-95013802 CTATGAAAAAGAAGAGAGACTGG - Intergenic
1103846929 12:123908265-123908287 ACATGCACAAGAACAGAGACAGG - Intronic
1105913226 13:24890682-24890704 CTGTGAACAAAAGCAGAGGCTGG - Intronic
1106051401 13:26193261-26193283 TAGTGTACAAGAACAGAGCCTGG + Intronic
1106250467 13:27978453-27978475 CTGCGGAGAAGCACAGACACCGG + Intronic
1107257902 13:38452536-38452558 CTGAGGAAAAGAACAGAGTTGGG - Intergenic
1109561236 13:64052803-64052825 CTGAAGGCAAGAACAGACACAGG + Intergenic
1113838574 13:113346096-113346118 CTGTGGCCGAGAACAGACCCGGG + Intronic
1113838582 13:113346126-113346148 CTGTGGACAAGAGCAGACCCGGG + Intronic
1113838649 13:113346422-113346444 CTGTGGCCGAGAACAGACCCAGG + Intronic
1113838657 13:113346452-113346474 CTGTGGACAAGAGCAGACCCGGG + Intronic
1113838685 13:113346572-113346594 CTGTGGCCGAGAACAGACCCGGG + Intronic
1113838743 13:113346810-113346832 CTGTGGACAAGAGCAGACCCGGG + Intronic
1113838750 13:113346840-113346862 CTGTGGACAAGAGCAGACCCGGG + Intronic
1113838867 13:113347344-113347366 CTGTGGCCAAGAACAGATCCGGG + Intronic
1113838954 13:113347730-113347752 CTGTGGCCAAGAACAGATCCGGG + Intronic
1113838981 13:113347848-113347870 CTGTGGCCAAGAACAGATCCGGG + Intronic
1116788352 14:49312539-49312561 CTGTGGCCAAGATCAGAGGTGGG - Intergenic
1116898394 14:50339030-50339052 CTTTGGACAAGAAAAGAAAAAGG + Intronic
1117835158 14:59796880-59796902 CTGTGGATATGAAGATAGACAGG - Intronic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1118709510 14:68508140-68508162 CACTGGACCAGAACAGAGCCTGG - Intronic
1119694223 14:76699857-76699879 CTCTGGACAAGACCAGAGACAGG - Intergenic
1121519551 14:94576726-94576748 TTGGAGGCAAGAACAGAGACAGG - Intronic
1121558892 14:94859746-94859768 CTGTGTCCAAGGGCAGAGACAGG + Intergenic
1121715771 14:96072680-96072702 GGGTGGACAACAGCAGAGACAGG - Intronic
1125061715 15:35433923-35433945 CTGTGGAAGAGAAAAGAGAAGGG + Intronic
1125770472 15:42162167-42162189 CTAGGGACAGGAACAGAGATAGG + Intronic
1126056401 15:44733904-44733926 CTCTGGCAAAGACCAGAGACAGG - Intronic
1126967333 15:54069867-54069889 CTGTGGCCAAGGAAAGAGAAAGG - Intronic
1128126032 15:65193633-65193655 GTTGGGACAAGAACAGAGTCTGG - Intergenic
1128310500 15:66629056-66629078 ATGTGGACAAGAATGGAGATTGG + Intronic
1129228692 15:74184595-74184617 GTGTGGACGAGAACAGAGGCTGG - Intronic
1130121317 15:81050037-81050059 CTGTGGAAATGAAAAGAGAAAGG + Intronic
1130577416 15:85105021-85105043 CTGTGGAGAAGAATAAAGCCAGG + Intronic
1132072086 15:98787202-98787224 GAGAGGACAAAAACAGAGACAGG - Intronic
1132082424 15:98878310-98878332 CTGTGTACAGTAACAGAGAATGG + Intronic
1134013823 16:10874648-10874670 TTGTGGACAAGAACTGGGTCTGG + Intergenic
1134266854 16:12700334-12700356 CTGGGGACCAGAGCAGAGAGAGG + Intronic
1134309829 16:13065681-13065703 CTGTAGGAAAGAACAGAGAAAGG + Intronic
1134342742 16:13360074-13360096 CTGGGGACTGGAACAGAGCCTGG + Intergenic
1134823113 16:17262646-17262668 CTATGGCCAAGAGCAGTGACTGG + Intronic
1135296255 16:21281953-21281975 CCTTGGCCAAGATCAGAGACAGG - Intronic
1135951438 16:26918054-26918076 CTGTTCACAATAGCAGAGACTGG - Intergenic
1136397707 16:30002097-30002119 TTGTGGAGAAGAACAGAGCGAGG + Intronic
1137379696 16:47986038-47986060 CTGTGGAAGAGAAGAGAGAGAGG + Intergenic
1138344141 16:56309510-56309532 GTGGGGACAAGGACAGAGAAGGG + Intronic
1138554972 16:57765686-57765708 CAGTGGACCAGAATGGAGACTGG - Intronic
1139691042 16:68642320-68642342 CCGTGTACAAGAACAAGGACAGG - Intronic
1140406465 16:74714437-74714459 CTGGGGACAATAAAAGACACAGG - Intronic
1141283866 16:82653402-82653424 CTTTGGAGGAGAACAGAGAGAGG + Intronic
1141302811 16:82833764-82833786 CTGTGGACTTGCACAGAGCCAGG - Intronic
1142348498 16:89569350-89569372 CTGTGGAGAAGACGAGACACTGG + Intergenic
1142497517 17:314250-314272 CTGTGGAGAGGCACAGAGCCTGG - Intronic
1142609893 17:1103296-1103318 CGGGGGACAAGATCAGAGCCTGG + Intronic
1142642570 17:1292956-1292978 GGGTGAAGAAGAACAGAGACTGG + Intronic
1143104229 17:4520364-4520386 CTGTGGGCAAGAGGAGAGAATGG + Intronic
1143464837 17:7129656-7129678 CTGTGGAGAAAAACAGAGCAAGG - Intergenic
1144368626 17:14569141-14569163 GTGATGACAAGAGCAGAGACTGG - Intergenic
1146481351 17:33207485-33207507 TTGTAGACAAGAAAAGAAACAGG + Intronic
1147300146 17:39519933-39519955 CTATGGAAAAGAACACAGAAAGG - Intronic
1147322176 17:39653118-39653140 CTGTTGACAGGACCAGAGGCTGG + Intronic
1147332977 17:39709790-39709812 CTGAGGACAGAACCAGAGACAGG - Intronic
1148804513 17:50257525-50257547 CCTTGGACAAGAACAAACACTGG - Intergenic
1148962466 17:51405007-51405029 CTGTGGAGAGGAACAGCAACAGG + Intergenic
1149065878 17:52478653-52478675 CTCTGGCCAAGACCAGAGACAGG - Intergenic
1149133222 17:53333513-53333535 CTGGGGCCAGGAAGAGAGACTGG - Intergenic
1150014272 17:61538050-61538072 CTGAGGAGAAGGAGAGAGACAGG - Intergenic
1150716505 17:67576764-67576786 GTGTGGACAAAGACAAAGACAGG + Intronic
1151585304 17:75004939-75004961 ATGGGGGCAAGCACAGAGACGGG - Exonic
1151759168 17:76090881-76090903 CAGGAGACAAGGACAGAGACAGG + Intronic
1152260195 17:79262654-79262676 CTGTGGACAAGCCCACAGGCAGG + Intronic
1153631520 18:7075283-7075305 CTGTGAACAAGAAAAGAGGAGGG + Intronic
1153826018 18:8875588-8875610 CTTGGCACAAGCACAGAGACTGG + Intergenic
1157060687 18:44285588-44285610 CTCTGGAGAAGAACAGTAACTGG + Intergenic
1157415981 18:47503452-47503474 CTGTGGCCAAGCACAGAGTGAGG + Intergenic
1157680029 18:49597834-49597856 CTGAGGCCAGGAACAGAGGCAGG + Exonic
1158932966 18:62339049-62339071 TTTTAGACAAGAACAGAGCCTGG - Intronic
1161406822 19:4095450-4095472 CTGTGGAGGAGAACAGAGGGTGG + Intronic
1162067211 19:8133107-8133129 CTGGGGACAACAGCAGAGGCTGG + Intronic
1162290359 19:9775390-9775412 CTGTGGATAGGAACAGGAACAGG + Intronic
1163188542 19:15658566-15658588 GAATGGACAAAAACAGAGACGGG - Intronic
1163333524 19:16657004-16657026 CTGTGCAGAAGGACAGAGGCAGG - Intronic
1164442313 19:28288643-28288665 CTTTGGCCAAGACCAGAGACAGG + Intergenic
1164709506 19:30345269-30345291 CTGGGGACAGGAACAGAGAAAGG - Intronic
1165370150 19:35400262-35400284 CTTCGGCCAAGACCAGAGACAGG - Intergenic
1165574057 19:36799024-36799046 GTGTAGACAAGAAAAGAGAGAGG - Intergenic
1165668340 19:37653879-37653901 CAGTGGACCAGAACAGGGATTGG - Intronic
1166918000 19:46208944-46208966 CTGTGGGCAAGAAGAGAGGCGGG + Intergenic
1167086562 19:47313798-47313820 CGGTTAGCAAGAACAGAGACAGG - Intronic
1167319074 19:48784547-48784569 GGGTGGACTAGAACAGGGACTGG + Intergenic
1167427918 19:49439022-49439044 CAGGGGACAAGGACAGAGAAGGG + Intronic
1167462508 19:49633299-49633321 CTGTCTACAAAAATAGAGACAGG - Intergenic
925222063 2:2149905-2149927 CTGTGGTCCAGATGAGAGACAGG - Intronic
925263534 2:2548116-2548138 CAGTGGGCAGGGACAGAGACAGG - Intergenic
925518655 2:4715030-4715052 CTGAGGACAGGAACAGACAAAGG + Intergenic
926705425 2:15834210-15834232 CTGTGGGCAAGGACTGAGCCTGG + Intergenic
927758424 2:25727653-25727675 CTGGGGACAAAAAAAGAGAAGGG + Intergenic
928654785 2:33439419-33439441 CTGTGAGCATGAGCAGAGACAGG + Intronic
928660118 2:33493315-33493337 CTGGGGACAACAACAGTGAGAGG + Intronic
928919595 2:36512865-36512887 CTGTGAATAAGCACAGAGCCTGG + Intronic
929051181 2:37838299-37838321 CAGTGGTCTAGGACAGAGACGGG + Intergenic
929562556 2:42964788-42964810 CTGTGGAGAGGGACAGAGAGGGG + Intergenic
929606939 2:43240977-43240999 CTGTGGACAAGGGCACAGACAGG - Intronic
930013567 2:46955925-46955947 CTGAGGACAGGATCAGAGGCAGG + Intronic
930489364 2:52048680-52048702 CTGAGGAAAAGAAGAGAGAAAGG + Intergenic
931089935 2:58874955-58874977 CTGGGGAGGAGAAAAGAGACAGG + Intergenic
931249405 2:60516607-60516629 ATATGGACAAGGACAGAGAGGGG + Intronic
931499632 2:62850974-62850996 CTGTGGATAGCAACTGAGACTGG - Intronic
932645853 2:73500818-73500840 CTGTGGAAAATAACAGAAGCAGG - Intronic
933091468 2:78124452-78124474 GTGTGCAAAAGAACAGATACTGG + Intergenic
933788027 2:85859350-85859372 CAGAAGACAAAAACAGAGACAGG + Intronic
933845516 2:86323385-86323407 CTGCAGACAAGGACGGAGACTGG + Intronic
934056853 2:88258446-88258468 CTGTGAACAAGTCCAGAGCCTGG - Intergenic
934689964 2:96350934-96350956 CTGGGCATAAGAACAGGGACAGG - Intronic
934924162 2:98370111-98370133 CTGTGGAAATGACCAGAGCCAGG - Intronic
935183113 2:100707490-100707512 CTTTGGAAAAGAATATAGACAGG + Intergenic
935272249 2:101445005-101445027 ATGTGGATAAGAGCAGATACTGG - Intronic
936396503 2:112135878-112135900 CTGAGGACAAAGACAGAGAAAGG + Intergenic
938188043 2:129250925-129250947 GTGTGCATAAGAACAGAGATAGG + Intergenic
938930642 2:136083761-136083783 CTGTGAACAACAACAGAAATGGG - Intergenic
938938306 2:136146902-136146924 CTGTGAACCAGAACTGAGCCAGG - Intergenic
939635102 2:144572346-144572368 CTGTGAACCAGAACAGACATAGG - Intergenic
942747788 2:179255106-179255128 CTGAGGAGAAGGAGAGAGACAGG - Intronic
943246995 2:185467379-185467401 CTGTGAAGAGGGACAGAGACAGG + Intergenic
945213725 2:207411689-207411711 CTGAGGAGAGGAAAAGAGACGGG - Intergenic
945356571 2:208846865-208846887 GTGAGGACAAGACCAGAGAGTGG + Intronic
947626527 2:231622632-231622654 CTGAGGACAAGCAGAGAGAGTGG - Intergenic
947960088 2:234229168-234229190 CTGTGGGAAAGGACAGAGTCAGG + Intergenic
948086963 2:235258727-235258749 CTGTGGACAGGACCAGTGCCTGG - Intergenic
948670633 2:239566472-239566494 CAGTGGAGATGAAGAGAGACAGG + Intergenic
1169172007 20:3472299-3472321 CTGTGGACAAGGCCAAAGTCTGG - Intronic
1172438300 20:34946099-34946121 CTGTGATCAAGAAGAGAGAATGG + Intronic
1173345800 20:42198974-42198996 TTGTGGACATAAATAGAGACAGG - Intronic
1173575075 20:44107773-44107795 CTGTGGATAGGAAGAGATACAGG + Intergenic
1173699203 20:45052584-45052606 CTGTTGACAAGAAAAAAGCCTGG - Intronic
1174188163 20:48721731-48721753 CAGAGGACAAGAACAGAGGCAGG + Intronic
1174659138 20:52195399-52195421 CTGGGGCCTAGAACAGAGCCTGG + Intronic
1174870289 20:54174836-54174858 CGGTGTAGAAGAACAGAGGCGGG - Intergenic
1175112743 20:56660164-56660186 CTGAGGACAAGAGCAGGGATGGG - Intergenic
1176074777 20:63243469-63243491 CTGTGGAGAAGGATAGAGCCGGG - Intronic
1176893026 21:14342297-14342319 CTGTAGCCAGGAACAGATACTGG + Intergenic
1178486020 21:33020621-33020643 CTGGGGCCCAGAACAGGGACAGG - Intergenic
1179386976 21:40952798-40952820 CTGAGGAGAGGAAGAGAGACAGG - Intergenic
1179417634 21:41210962-41210984 CTTTGTGCAAGAACAGAGACAGG - Intronic
1180875617 22:19173906-19173928 CTGTGGAGAGGGACAGGGACAGG + Intergenic
1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG + Intronic
1182898618 22:33879260-33879282 CTGTATATAAGAAAAGAGACTGG - Intronic
1183032107 22:35113988-35114010 CTGAGGACAAGAACATGGACAGG + Intergenic
1183245402 22:36689474-36689496 CTGTGAACTAGCACAGAGTCTGG + Intronic
1183975056 22:41507149-41507171 CAGTTTTCAAGAACAGAGACCGG - Intronic
1184205849 22:43002132-43002154 CTCTGGAGATGAACAGAGCCAGG + Intronic
1184536107 22:45088080-45088102 CTCCGGCCAAGACCAGAGACAGG - Intergenic
1185315071 22:50175409-50175431 CTGGGGAAGAGAACAGGGACAGG - Intronic
949917205 3:8974382-8974404 CTGTCGAGAAGAACACAGGCAGG - Intergenic
950574010 3:13820156-13820178 CTGTGTACAGGCACAGAGATGGG + Intronic
952219820 3:31313751-31313773 CTGTGGACCACAAGAGAGAATGG - Intergenic
952321020 3:32277673-32277695 CTGTGGACCAGAAATGATACTGG + Intronic
953274288 3:41479664-41479686 CTGTGAAAAACAGCAGAGACAGG + Intronic
955267818 3:57464199-57464221 CTGTGGACAAGCAGAGACAAAGG + Intronic
955400466 3:58587515-58587537 GTGTGGCCCAGAACAGAGGCTGG + Intronic
958595179 3:96213342-96213364 CTGTGGACCAGATTAAAGACTGG + Intergenic
958634872 3:96730906-96730928 GGGTGGCCAAGGACAGAGACTGG + Intergenic
958758829 3:98282503-98282525 CTCTGGCCAAGACCAGAAACAGG - Intergenic
959717109 3:109444742-109444764 CTGAAGAGAAGAACACAGACTGG + Intergenic
961907217 3:130275515-130275537 CTCTAGCCAAGACCAGAGACAGG + Intergenic
962604547 3:137022872-137022894 CTCTGGCCAAGACCAGAGACAGG + Intergenic
963000824 3:140680082-140680104 CTGTGCAGAGGAGCAGAGACAGG + Intronic
963757831 3:149254269-149254291 CTGTGGATGAGAACAGAAAAAGG + Intergenic
964661644 3:159126310-159126332 CTGTGAAGAACAACAGAGAAAGG + Intronic
964730701 3:159861390-159861412 ATCTGGACAAGAACAAAGAGGGG - Intronic
965557244 3:170031262-170031284 CTCTGGCCAAGATCAGAGACAGG + Intergenic
965589180 3:170346445-170346467 CTGTTGCCAAAATCAGAGACTGG - Intergenic
967054403 3:185816320-185816342 CTGTGGGCAAGCACAGAGATGGG + Intronic
967491847 3:190101140-190101162 CTGAGGACAGGGAGAGAGACAGG - Intronic
967930012 3:194684326-194684348 ATGTGGACAAGAAGACAGAGTGG - Intergenic
968641029 4:1714901-1714923 CTCTGGCCAAGACCAGAGATGGG - Intergenic
968913657 4:3487875-3487897 CTGAAGACAAGCACAGTGACAGG - Intronic
972015867 4:34244775-34244797 TTGAGGACAAGAACAGGGTCAGG - Intergenic
972786390 4:42330334-42330356 CTGTGGACAGGTCCAGAGATGGG - Intergenic
972882144 4:43438071-43438093 TGGTGAACAAGAACAGAGAGAGG + Intergenic
974355603 4:60808850-60808872 CTGTGAACAAAGACAGAGAGGGG - Intergenic
975446321 4:74469547-74469569 TGGTGGACATGACCAGAGACAGG - Intergenic
976576166 4:86674023-86674045 CTGTGGAAAAGAACTGAAAATGG + Intronic
977865176 4:102016905-102016927 CTGTGGATAAGAATGGATACAGG + Intronic
978119316 4:105059544-105059566 CTGAGAACAGGAACAGAGAAAGG + Intergenic
981519916 4:145650577-145650599 CTGTGGACAAGAGCCACGACAGG - Intronic
981850845 4:149228692-149228714 CTCTGGCAAAGACCAGAGACAGG - Intergenic
984234982 4:177145701-177145723 CTCTGGCCAAGAACAGAGATTGG + Intergenic
984707616 4:182859286-182859308 CTCTGGCCAAGGCCAGAGACAGG - Intergenic
985311105 4:188600418-188600440 CTGAGGAGAAGGACAGAGATGGG + Intergenic
985865244 5:2509343-2509365 CTGAGGGCATGAACAGAGAAAGG - Intergenic
987541993 5:19268013-19268035 CTGTAGACAAAAAAAGACACTGG - Intergenic
987622087 5:20347479-20347501 CAGTGGAGAAGAACAGAGAGAGG + Intronic
987895327 5:23938563-23938585 ATGGGGACAAGAACATACACTGG - Intergenic
989785347 5:45321002-45321024 CAGTAGACAAGAACAAATACCGG - Intronic
990827187 5:59914261-59914283 CTGTGGAGAAAAACAAAGATGGG + Intronic
993087279 5:83378590-83378612 CTGTGGTAAAGAGCAGAGTCTGG + Intergenic
995099613 5:108283421-108283443 CAGTTGACAAGAACAAACACTGG + Intronic
995138677 5:108708006-108708028 CTGTGGGCAGGAACATAGAAAGG - Intergenic
996512751 5:124335567-124335589 CTGAAGACGAGAAAAGAGACTGG - Intergenic
997185673 5:131879592-131879614 CTGTGGGCAAGAGGAGATACAGG - Intronic
997715071 5:136036511-136036533 CTCTCTACAAGAACAGAGATGGG - Intronic
998228577 5:140345216-140345238 CTGTGGCCAAGTACAGGTACAGG - Intronic
999271593 5:150299625-150299647 CGGTGGTCAGGAACAGAGCCAGG + Intronic
999610476 5:153364030-153364052 CTGTGAAAAAGGACAGATACAGG - Intergenic
1001863796 5:175085040-175085062 CTGTCAACAGGAACAGTGACAGG + Intergenic
1001942605 5:175751225-175751247 CTGTTGCCAAGATCAGAGGCAGG + Intergenic
1002073490 5:176694660-176694682 CTGAGGACAAGGACAGTGACTGG - Intergenic
1002168196 5:177360991-177361013 CTGTGGGCAAACACAGGGACAGG + Intronic
1003534750 6:6966998-6967020 CTGAGGCCAAGAACTGAGGCAGG - Intergenic
1004462251 6:15848508-15848530 GTGGGGAGAAGATCAGAGACAGG - Intergenic
1004787845 6:18988909-18988931 CTGTGGACAAAACCTGAGTCAGG - Intergenic
1006543810 6:34762758-34762780 CTGTGAAAAACACCAGAGACAGG - Intronic
1006576947 6:35053418-35053440 CTGTGGTCCAGAAGAGGGACAGG + Intronic
1006764851 6:36495868-36495890 CTGACTACAAGAACAAAGACTGG - Exonic
1006977555 6:38117462-38117484 ATGTGGTCAAGAAGAGAGAAAGG - Intronic
1006986359 6:38178319-38178341 CTCTGCACACCAACAGAGACAGG + Intronic
1007279156 6:40697587-40697609 CTGTAGAGAAGAACAGTGACAGG - Intergenic
1009858487 6:69293879-69293901 CTGTCGGAAAGAACATAGACAGG + Intronic
1011193498 6:84760254-84760276 CAGTGGACAACAAAAGATACAGG - Exonic
1011385281 6:86790270-86790292 CTGTGCACAAGACCAGGGACTGG - Intergenic
1012429677 6:99151623-99151645 CTGTGGTGAAGTACACAGACTGG - Intergenic
1014294315 6:119600183-119600205 CTGTGGAAAAGAAGGGATACAGG + Intergenic
1015272463 6:131351270-131351292 CTGTTGACATGAACAGACAAAGG - Intergenic
1015444302 6:133285671-133285693 ATGATGACAAGAGCAGAGACTGG + Intronic
1015994118 6:138980438-138980460 CTGTGGACAAGAGGGGAGAATGG - Intronic
1016370249 6:143366257-143366279 TTGTGGACAAGAATAAAGAGAGG - Intergenic
1017638675 6:156468571-156468593 CTGTGGACACAAACAGGGCCTGG + Intergenic
1017764216 6:157593550-157593572 CTGGGGACAGGAAAAGAGGCAGG + Intronic
1018398572 6:163400381-163400403 CTGAGGACTAGAACAGGGAGAGG - Intergenic
1019085589 6:169473213-169473235 CTGTTTACATGGACAGAGACCGG - Intronic
1019357719 7:589618-589640 CTGAGGCCAAGAACTGAAACGGG + Intronic
1020718875 7:11716272-11716294 CTGGGGACTAGAACAGTCACAGG - Intronic
1020944549 7:14585944-14585966 CTGAGGACACAAAGAGAGACAGG - Intronic
1020992406 7:15216282-15216304 CTGTGGACAAGAACAGAGACAGG - Intronic
1021984791 7:26087936-26087958 CTGGGAACAAGAACAGAGAGAGG + Intergenic
1023528088 7:41126129-41126151 CTGGGGACAAGGATAGAAACAGG + Intergenic
1024035790 7:45506458-45506480 GTGTGGACAAGAAGGGAAACTGG - Intergenic
1026164037 7:67894263-67894285 CTGGGGAGAACAACAGAGCCAGG - Intergenic
1027385347 7:77654347-77654369 CTGTGGAAAGGAAAAGAGAAGGG - Intergenic
1028260992 7:88665048-88665070 CTGTGGTTAAGAAAAGGGACAGG - Intergenic
1029289749 7:99493203-99493225 TTCTGGACAAGAAAAGAAACAGG + Intronic
1029947672 7:104550350-104550372 CTGGGGAGAAGAATAGAGAGTGG + Intronic
1030273528 7:107695259-107695281 CTGGGGAAAAGCACAGACACAGG + Intronic
1031554977 7:123163259-123163281 TTGTAGACAAGAAAAGATACTGG - Intronic
1032650490 7:133872934-133872956 CTGCGGAGGAGAACAGAGATAGG - Intronic
1033579005 7:142714561-142714583 TTCTGGAGAAGAACAGAGAAGGG + Intergenic
1033710185 7:143934840-143934862 CTGTGGAGAAGAGTAGAGCCTGG + Intergenic
1034697422 7:153066270-153066292 CTGTGTAGAAAAACAGAGACAGG - Intergenic
1035166064 7:156990596-156990618 CTGTGGACAAGTGCTGAGATAGG + Intergenic
1037395499 8:18437496-18437518 CTGTGGACATGAGAAGAAACAGG - Intergenic
1038713513 8:29971411-29971433 CTGTGGCCAAGAAGACAGACTGG + Intergenic
1040554651 8:48468103-48468125 CTGTGCACAAGGCCAGAGAGTGG + Intergenic
1041682655 8:60608808-60608830 CTGTAGACTAGAATAGAGAAGGG - Intronic
1042509241 8:69593918-69593940 CTGTGGACAAAAGCCGTGACAGG + Intronic
1043193378 8:77255993-77256015 CTGTGTCCAAAAACAGGGACTGG + Intergenic
1043944763 8:86237524-86237546 CTGAGGAAAAGGAAAGAGACAGG + Intronic
1044999964 8:97870071-97870093 CCGTGGTCGAGAGCAGAGACTGG + Intronic
1045536811 8:103037135-103037157 GTGTTGTGAAGAACAGAGACAGG + Intronic
1045919840 8:107516819-107516841 GAGTGGACAGGGACAGAGACTGG + Intergenic
1047221794 8:122924581-122924603 CTGTGGAGATCAAGAGAGACTGG - Intronic
1047225267 8:122951269-122951291 CTGTGGACAAGAACAAAGACAGG - Intronic
1047306545 8:123657530-123657552 CTGTGGCCTAGAACAGGGACTGG + Intergenic
1047489435 8:125362485-125362507 CTGTGGACTAGGGCAGGGACTGG + Intronic
1048288916 8:133164714-133164736 CTGTGGAGAAGGACAGTGAATGG - Intergenic
1049199240 8:141331795-141331817 CTGAGGCCAAGAACAGAAGCAGG - Intergenic
1049370944 8:142266638-142266660 CTGTGGAACAGCACAGAGAAAGG - Intronic
1051009870 9:12398312-12398334 CTGAGGACAAGGAAAGAGATGGG - Intergenic
1055070716 9:72163063-72163085 CAGTGGACCACAAAAGAGACAGG + Intronic
1055380281 9:75699120-75699142 CTGTGGTCAAGAACAGACATGGG + Intergenic
1055673050 9:78626467-78626489 CTATGGCCAAGGACAGAGACGGG - Intergenic
1057594104 9:96400099-96400121 CTGAGAAGAAGAACAGACACTGG + Intronic
1057717382 9:97505339-97505361 CTGAGAACATGAACTGAGACAGG - Intronic
1057880726 9:98790950-98790972 CTGTGGCCAGGCACAGAGCCAGG - Intronic
1058119113 9:101119147-101119169 CTGTGGACAAGAACATGGTAAGG - Intronic
1059107216 9:111522076-111522098 CTGTGTACGGGAACAGAGGCTGG + Intergenic
1059987178 9:119831789-119831811 CTGATGGCAAGAACAGAGGCTGG + Intergenic
1060021891 9:120138802-120138824 CTGTGGGAAAGAACATAGCCCGG - Intergenic
1060587564 9:124795939-124795961 CTGGGGACAAGGACAGAGTTGGG + Intronic
1060883849 9:127136896-127136918 CTGCTGACAAGAACAGAGCCTGG - Intronic
1061384284 9:130279191-130279213 CCGTGGTGAAGGACAGAGACAGG + Intergenic
1186667507 X:11733098-11733120 CTGTGGAGAAAAAGAGATACAGG - Intergenic
1186693002 X:11999219-11999241 CTGTGGACATGGATAGAAACAGG - Intergenic
1186754710 X:12658366-12658388 CTGTGGACATGCATAGAGGCAGG + Intronic
1186943798 X:14542153-14542175 CTTTGGACAAGACCAGAGACAGG + Intronic
1187311024 X:18142878-18142900 CTGAGGAGAAGGAGAGAGACAGG - Intergenic
1187520851 X:20012741-20012763 CTCTGGAGAAGAGCAGAGTCAGG + Intronic
1187798209 X:23028111-23028133 CAGAGGACAAGAACAGAGGGTGG - Intergenic
1188542874 X:31268970-31268992 CTGTTGACAAGAAAAAAGAATGG + Intronic
1190410201 X:50129530-50129552 CTGTGGAAAAGACCAGAGGCAGG + Intergenic
1190582578 X:51903292-51903314 ATGTGGACAAGGGCAGAGACGGG + Intergenic
1192679458 X:73236705-73236727 CTCTGGCAAAGACCAGAGACAGG - Intergenic
1193906012 X:87244980-87245002 CTGAGGACAGGTACAGAGATAGG - Intergenic
1196222440 X:113126882-113126904 CTCTGGAGAAGAGAAGAGACTGG - Intergenic
1196828674 X:119759609-119759631 CCGTTGACAGGGACAGAGACTGG + Exonic
1198307669 X:135398978-135399000 CTCTGGCCAAGACCACAGACCGG + Intergenic
1198914213 X:141649477-141649499 CTGGGGACATGAACAGAGGGTGG - Intronic
1199146886 X:144379372-144379394 GTGTGAACAAGAACAAAGGCAGG - Intergenic
1200040456 X:153362298-153362320 CTCTGGCCAAGACAAGAGACAGG - Intergenic