ID: 1020998032

View in Genome Browser
Species Human (GRCh38)
Location 7:15289831-15289853
Sequence AAATGAGTATTCTCTTGGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020998032 Original CRISPR AAATGAGTATTCTCTTGGGT AGG Intronic
900794591 1:4700430-4700452 ACATGAGGATCCTCTGGGGTGGG - Intronic
902335646 1:15753022-15753044 AAGTGACTATTTTTTTGGGTGGG + Intergenic
903056578 1:20640336-20640358 AAATGAGTGTTCCCTCTGGTGGG - Intronic
903159498 1:21475736-21475758 GAATGAATATTCTGTTGGTTTGG + Intronic
904718732 1:32489960-32489982 AATTGAGTATTCTGGTGGTTTGG + Exonic
905525185 1:38632613-38632635 GAATGTGTATTCTGTTGGTTTGG + Intergenic
906549092 1:46646943-46646965 AAATGAGTACTTTTTTGGTTTGG + Intronic
909387655 1:75078097-75078119 AAATGATGATTCTCTTGCATAGG - Intergenic
909408996 1:75327656-75327678 TAATGATTATTTTGTTGGGTTGG - Intronic
910381091 1:86627803-86627825 AAATGTGTATTCTGTTGATTTGG + Intergenic
910393365 1:86767150-86767172 AAATGAGGGTTCTCTTGGCTGGG + Intergenic
911141740 1:94510453-94510475 AAATGTGTATTCTGTTGATTTGG + Intronic
912009200 1:104938608-104938630 AAATGTGTATTCTGTTGATTTGG + Intergenic
912280965 1:108313092-108313114 AAATGAACATTCTCTTCTGTGGG - Intergenic
913097450 1:115532607-115532629 AAAACAGTGTTCTCTTTGGTGGG + Intergenic
913582038 1:120235590-120235612 AACTGAGTATACTCATGGGATGG + Intergenic
913626136 1:120662801-120662823 AACTGAGTATACTCATGGGATGG - Intergenic
914563969 1:148847051-148847073 AACTGAGTATACTCATGGGATGG + Intronic
914608857 1:149283167-149283189 AACTGAGTATACTCATGGGATGG - Intergenic
915350759 1:155223891-155223913 AAATGATTTCACTCTTGGGTGGG + Intergenic
917181681 1:172304561-172304583 GAATGTGTATTCTCTTGATTTGG - Intronic
917502888 1:175601811-175601833 ATATGACTATTCTATTAGGTAGG - Intronic
918824040 1:189299085-189299107 GAATGTGTATTCTGTTGGTTTGG + Intergenic
920753557 1:208705360-208705382 AAATGAATATTCTGTTGATTTGG - Intergenic
921297864 1:213721731-213721753 ATATGAGAACTCTCTTGGGTGGG - Intergenic
922035498 1:221843987-221844009 AAAAGAGTATGCTCTTTGGGGGG + Intergenic
924864020 1:247958405-247958427 AAATGTGTATTCTGTTGATTTGG + Intronic
1063683313 10:8211554-8211576 AGAGGAGGATGCTCTTGGGTGGG - Intergenic
1064429483 10:15258489-15258511 AAATGAGTATTTTTGTTGGTTGG - Intronic
1064921946 10:20529150-20529172 AAATGTATATTCTGTTGGTTTGG + Intergenic
1064924822 10:20558086-20558108 AAATGTATATTCTGTTGGTTTGG - Intergenic
1065863879 10:29896335-29896357 ACATGAGTTTTCTCTTTGGTAGG + Intergenic
1067053014 10:43035816-43035838 TAAGCAGTATTCTGTTGGGTGGG - Intergenic
1067548892 10:47219348-47219370 AAATAAGTATTCTCAGGGTTTGG + Intergenic
1067893913 10:50159685-50159707 CACTGATTATTCTCTTGGGTTGG - Intergenic
1067954933 10:50780579-50780601 CACTGATTCTTCTCTTGGGTTGG + Intronic
1068295883 10:55071775-55071797 AAATGTATATTCTCTTGATTTGG - Intronic
1068720332 10:60238308-60238330 AAATGAGGGTTCTCTTAGGCAGG - Intronic
1069279785 10:66640643-66640665 AAATGAGTATTCTGTTTGCTGGG - Intronic
1072245283 10:93537929-93537951 AAATGTGTATTCTTTTGACTTGG - Intergenic
1073314595 10:102570218-102570240 AAATAAATATTCTCTCGGTTCGG - Intronic
1074679325 10:115887962-115887984 AAAAGAGTAATCTTTTGGATAGG + Intronic
1075611251 10:123856463-123856485 AAAGGAGGATTCTTTGGGGTGGG + Intronic
1076055202 10:127367261-127367283 AAAGGAGTAGGCTCTTGGGGAGG - Intronic
1076187483 10:128460671-128460693 AACTGAGGATTCTGTTGGGGTGG - Intergenic
1080166145 11:29240273-29240295 AAATCAGGATTCTTTTGGGAAGG - Intergenic
1081454691 11:43210161-43210183 AAATGTATATTCTCTTGATTTGG + Intergenic
1082314960 11:50706752-50706774 AAATGTATATTCTCTTGATTTGG + Intergenic
1085369473 11:75986721-75986743 ACATGAGTTTTCTTTTAGGTAGG - Intronic
1086075361 11:82845304-82845326 AAATGTGTACTCTCATAGGTAGG - Intronic
1086800768 11:91171906-91171928 AAATGTATATTCTCTTGTTTTGG - Intergenic
1088309342 11:108443503-108443525 AAATGTATATTCTCTTGATTTGG - Intronic
1090601879 11:128380663-128380685 AAAAGAGTTTTCTCTGGGGAGGG - Intergenic
1090784126 11:130033318-130033340 AAACGAGTCTTCTCTGGGGGAGG - Intergenic
1091606953 12:1961197-1961219 AAATGAGTATTCTGTTTGGCAGG + Intronic
1092266424 12:6984532-6984554 CATTGATTATTCTCTTGAGTTGG + Intronic
1093108541 12:15119546-15119568 GAATAAGTATTCACTTTGGTGGG + Intronic
1093265716 12:17000981-17001003 AAATGTATATTCTCTTGATTTGG - Intergenic
1094704217 12:32898696-32898718 AATTGATTATCCTGTTGGGTAGG + Intergenic
1095072124 12:37866196-37866218 AAATGTGTATTCTGTTGATTTGG + Intergenic
1095340616 12:41084920-41084942 AAATGAATATTCTGTTGATTTGG + Intergenic
1095442524 12:42252359-42252381 AAATGTATATTCTCTTGATTTGG + Intronic
1095489602 12:42719352-42719374 AAATGAGGGTTCTCCTGGCTAGG - Intergenic
1095558821 12:43540790-43540812 AAACTAGTTTTCACTTGGGTAGG + Intronic
1098492645 12:71100150-71100172 AAATGTATATTCTCTTGATTTGG - Intronic
1099268631 12:80480051-80480073 AAATGTATATTCTCTTGATTTGG - Intronic
1101100644 12:101388721-101388743 AAATGAATATTCTGTTGATTTGG - Intergenic
1103466247 12:121144176-121144198 ATATTAGTATTCTATTGGGCAGG - Intronic
1103526424 12:121572236-121572258 ATCTGATTATTTTCTTGGGTTGG - Intronic
1105620959 13:22065520-22065542 AAATGAGCAGGATCTTGGGTGGG + Intergenic
1107535857 13:41330678-41330700 AAATTAGGTGTCTCTTGGGTGGG + Intronic
1108827223 13:54427786-54427808 AGATGAGTGTTCTCTTGCATTGG + Intergenic
1111571320 13:90090033-90090055 GAATGAGTTTTCTCTCTGGTGGG - Intergenic
1112190641 13:97174130-97174152 AAATGAGATTTCTCTTAGGCAGG + Intergenic
1112584006 13:100700636-100700658 AAATGTGTATTCTGTTGATTTGG - Intergenic
1112602712 13:100872533-100872555 AAATAAGTTTTCTCTTGGCAGGG - Intergenic
1113033929 13:106027488-106027510 AAATGAATATTATGTTGTGTAGG - Intergenic
1113048273 13:106180458-106180480 AGATGAGCCTTCTCTGGGGTGGG - Intergenic
1113081510 13:106525365-106525387 AAATGAGTATGATCATGGATAGG - Intronic
1114079064 14:19186647-19186669 AAATGTATATTCTGTTGGTTTGG + Intergenic
1115281200 14:31665693-31665715 GAATGTGTATTCTCTTGATTTGG + Intronic
1116061082 14:39924974-39924996 AAATGTATATTCTCTTGATTTGG + Intergenic
1116216828 14:42027094-42027116 CAATGATTATTTTATTGGGTAGG + Intergenic
1117502087 14:56363054-56363076 GAATGTGTATTCTCTTGATTTGG + Intergenic
1117931391 14:60844703-60844725 AAATGATTTCTCTCTTAGGTGGG - Intronic
1118055848 14:62078817-62078839 AAATGAGAATTATATTGTGTGGG + Intronic
1119172891 14:72547927-72547949 ATATGAGTATTTTCTGGAGTGGG - Intronic
1119761437 14:77154842-77154864 AAATGAGTATTTTAAAGGGTGGG - Intronic
1120567465 14:86077958-86077980 AAATGTATATTCTCTTGATTTGG + Intergenic
1124828157 15:33120543-33120565 AAAATAGTAATCTCTGGGGTTGG - Intronic
1126505892 15:49404223-49404245 GAATGTGTATTCTCTTGTTTTGG + Intronic
1127167796 15:56265794-56265816 AAAAGAATATTCTCTTGTGTGGG + Intronic
1130820865 15:87494173-87494195 AAATGGTTATTCTCTTTTGTTGG - Intergenic
1131584449 15:93677942-93677964 AAATGTATATTCTCTTGATTTGG - Intergenic
1138471203 16:57238194-57238216 AAATGAGTCTCTTCTTGGATAGG + Intronic
1138833674 16:60407329-60407351 AAAGGACTATTCTCTTTTGTGGG + Intergenic
1139593486 16:67945642-67945664 AAATGAGCACTAGCTTGGGTAGG + Intronic
1143832845 17:9666168-9666190 ACATGAGTATTCTCTTTTGCAGG - Intronic
1144234135 17:13240574-13240596 AAATGAGGAATTTGTTGGGTGGG - Intergenic
1145690931 17:26738369-26738391 AAATGTATATTCTCTTGATTTGG - Intergenic
1153124372 18:1772545-1772567 AAATTAGTCTTGTCTTAGGTTGG - Intergenic
1153355178 18:4126151-4126173 AAGTGAGTCCTCTCATGGGTAGG + Intronic
1153504438 18:5781104-5781126 ATTTAAATATTCTCTTGGGTTGG - Intergenic
1154111624 18:11573566-11573588 AAATGTGTTTTCTCTTGTTTAGG - Intergenic
1155001256 18:21689252-21689274 AAATGCGCAGTCTCTTGGCTGGG + Intronic
1155723331 18:29047417-29047439 AAATGTATATTCTGTTGGTTTGG + Intergenic
1156639910 18:39080755-39080777 AAATGTGTGGGCTCTTGGGTTGG + Intergenic
1157050983 18:44164239-44164261 GAATGTGTATTCTCTTGATTTGG + Intergenic
1157900982 18:51517030-51517052 AAATGTGTTTTCTCTTTGTTTGG + Intergenic
1160087698 18:75793641-75793663 AAATGTGTATTCTCTTCGTTTGG - Intergenic
1163487378 19:17596123-17596145 AAAAGAGTATTGTCTTAAGTTGG - Intergenic
1164347453 19:27284008-27284030 AAATGTATATTCTCTTGATTTGG + Intergenic
1167700544 19:51041702-51041724 AAATCAGTATTGTCATGGTTAGG - Intergenic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
1168679158 19:58301160-58301182 AAATGAGTTTTGTTTGGGGTAGG - Exonic
925147777 2:1592344-1592366 AGATGAGTATTCTCAAGTGTGGG + Intergenic
925958229 2:8990513-8990535 AAATGAATATTTCATTGGGTAGG - Intronic
925963515 2:9040994-9041016 AAATGTGTATTCTGTTGATTTGG - Intergenic
926037082 2:9644134-9644156 ACATGGGTTCTCTCTTGGGTAGG - Intergenic
926194184 2:10752147-10752169 AAATGTGTTCCCTCTTGGGTGGG + Intronic
926939114 2:18116402-18116424 AAATGAGTATCAGCTTGGGGCGG + Intronic
927406618 2:22777684-22777706 ACATGAGTTTTCTATTAGGTCGG - Intergenic
927633229 2:24792762-24792784 AACTGAGTATTTACCTGGGTAGG - Intronic
928881321 2:36099677-36099699 AAATGTATATTCTCTTGATTTGG - Intergenic
929376587 2:41294361-41294383 AAATGTGTATTATATTGGGGTGG - Intergenic
930476586 2:51890207-51890229 AAAAGAGTATTTTTTTGTGTGGG + Intergenic
930924785 2:56803856-56803878 AAGTGAGTATTCTCTCAGGCAGG + Intergenic
930959839 2:57247972-57247994 AAATGTGTATTCTGTTGTTTGGG + Intergenic
931022227 2:58060358-58060380 AAATAAGTATTTTTTTGGGGAGG + Intronic
931205744 2:60143733-60143755 AAATGTGTATTCTGTTGATTTGG - Intergenic
931809271 2:65838759-65838781 AAATGAGCATGCTCTTGGCCAGG - Intergenic
932538639 2:72626995-72627017 AAATGAGTATTCTATTGCAGAGG + Intronic
933590536 2:84227415-84227437 AAATGTATATTCTCTTGATTTGG - Intergenic
936806963 2:116345849-116345871 AAATTAGTATTTTCTTGAGAGGG + Intergenic
936812264 2:116416099-116416121 GAATGACTATTCTCTTGTTTTGG - Intergenic
937793728 2:125992014-125992036 GAATGAGTATTCTCTATGCTGGG + Intergenic
939206306 2:139108247-139108269 AAATGTATATTCTCTTGATTTGG - Intergenic
939330001 2:140745716-140745738 AAATGACTATTACATTGGGTAGG - Intronic
939891124 2:147737622-147737644 TGATGAGTATTCTCTGGGGTGGG - Intergenic
939919978 2:148098285-148098307 AATTTAGTATTCTTTTGGATTGG + Intronic
940142920 2:150514224-150514246 AAATCAGAGTTCTCTTGGGAGGG - Intronic
940198094 2:151118715-151118737 AAAAGAGTAGTTTCTTTGGTAGG - Intergenic
940253175 2:151702329-151702351 AAATGTATATTCTGTTGGTTTGG + Intronic
940462297 2:153980567-153980589 AAATGAGTTTAGTCTTGGATAGG + Intronic
940700158 2:157030726-157030748 AAACGAATATTCTGTTGGGCAGG + Intergenic
941054292 2:160769161-160769183 AAATGTATATTCTCTTGATTTGG - Intergenic
941669327 2:168274442-168274464 AAATTATTAGGCTCTTGGGTAGG + Intergenic
943274035 2:185845195-185845217 AAATGTATATTCTCTTGATTTGG + Intergenic
943275967 2:185867139-185867161 AAATGTATATTCTCTTGATTTGG - Intergenic
943969911 2:194391383-194391405 AAATGTGTATTCTGTTGATTTGG - Intergenic
944338918 2:198571623-198571645 AAATTGGTGTTTTCTTGGGTGGG + Intronic
945873778 2:215255634-215255656 GAATGAATATTCTTTTGGTTTGG - Intergenic
946698329 2:222384400-222384422 AAATGTATATTCTCTTTGGGAGG - Intergenic
1168920249 20:1527761-1527783 GAATGTGTATTCTCTTGTTTTGG + Intergenic
1169516172 20:6319289-6319311 AAATGTATATTCTGTTGAGTTGG + Intergenic
1169742837 20:8913981-8914003 AAAAAAGAATTCTCTTTGGTTGG - Intronic
1170153855 20:13252070-13252092 AAAAGAGCATTTTCTTGGGTTGG + Intronic
1171162915 20:22944758-22944780 AAATAAGGATTCTGTTGGGTGGG + Intergenic
1172821705 20:37741282-37741304 AAATGAGTAGGCTCATGAGTAGG + Intronic
1174023248 20:47548970-47548992 AAATTAGTGTTTTCTTGGTTTGG + Intronic
1174131722 20:48349264-48349286 AAATCAGAAAACTCTTGGGTGGG + Intergenic
1174384574 20:50179491-50179513 AAATGTGTATTTTCCTGGTTTGG + Intergenic
1174817163 20:53696985-53697007 AAATGGGTATTCTCAAGAGTGGG + Intergenic
1174887718 20:54353916-54353938 AAATCAGGATGCTCTTGGATTGG - Intergenic
1178068906 21:28939264-28939286 ACTTGAGTATTCGCTGGGGTGGG + Intronic
1179291944 21:40026335-40026357 AAATGTGTATTCTGTTGATTTGG + Intronic
1179293089 21:40035693-40035715 AAATGTGTATTCTGTTGATTTGG - Intronic
1179301195 21:40112094-40112116 AAATGTGTATTCTGTTGATTTGG - Intronic
1182166024 22:28174344-28174366 AAGTGCGTATTATCTTGGTTGGG - Intronic
1182203334 22:28596518-28596540 AAATTACTATTCTATTGGTTAGG + Intronic
1183778571 22:39983959-39983981 AACTGAGTTTTCTCCTGGCTGGG + Intergenic
949678729 3:6488374-6488396 AAATGAATATTCTGTTGATTTGG + Intergenic
949714289 3:6910577-6910599 AAAGGAGTGTTCTCTTTAGTTGG + Intronic
949720917 3:6989005-6989027 AAATCAGTTTTCTTTAGGGTAGG + Intronic
950157939 3:10737976-10737998 CAATAAGTATTTTCTTGGGGAGG - Intergenic
950176964 3:10881750-10881772 AGAAGAGTATCCTCTGGGGTGGG - Intronic
950347213 3:12307403-12307425 AAATTACAATTCTCTTTGGTGGG - Intronic
951197906 3:19844830-19844852 AAATGTATATTCTGTTGGTTTGG + Intergenic
953101462 3:39833283-39833305 AAATGGGAATTTTTTTGGGTTGG + Intronic
954938003 3:54344648-54344670 AATTGAGTCTCCTCTTGGGTGGG + Intronic
955431711 3:58852517-58852539 AAATGTGTATTCTGTTGATTTGG - Intronic
955586401 3:60482360-60482382 GAATGTGTATTCTGTTGCGTTGG - Intronic
956045224 3:65189056-65189078 AAAAGAGTGCTCTGTTGGGTGGG + Intergenic
956594002 3:70946805-70946827 TAATGAATATACTCTGGGGTGGG - Intergenic
956790909 3:72679344-72679366 GCATGTGTATTCTCTTGGGAAGG + Intergenic
956978586 3:74611195-74611217 AAATGACTATTTTCTTAAGTAGG - Intergenic
958198935 3:90281698-90281720 AAATGTATATTCTCTTGACTGGG - Intergenic
958208305 3:90434117-90434139 AAATGTGTATTCTGTTGATTTGG + Intergenic
958698144 3:97553380-97553402 AAATAAGTAGTATCTGGGGTTGG - Intronic
959401927 3:105913467-105913489 AAATTAGTATTCTTTTCTGTTGG + Intergenic
959522543 3:107336380-107336402 AAATGTGTATTCTGTTGATTTGG - Intergenic
959553895 3:107695659-107695681 AAATGTGTATTCTGTTGATTTGG + Intronic
959659773 3:108853686-108853708 AAATGAGTATTCTGTTTCCTGGG - Exonic
960289868 3:115870963-115870985 TAATGAGTTTTCTCTTCTGTGGG - Intronic
960597829 3:119422640-119422662 AAATGAGGCTGCTCTTGGGGTGG - Intergenic
961677462 3:128576380-128576402 CAATGTGTCTTCTCTTTGGTTGG + Intergenic
962506745 3:136054029-136054051 AAATGAGAATTTTTTTGGGGGGG + Intronic
962536467 3:136333650-136333672 AGTTGAGTGTTCTCTTGTGTGGG + Intronic
965003419 3:162986887-162986909 AAATGAGTTTTCTGTGGGGGAGG + Intergenic
965465095 3:169019570-169019592 AAATGAACATTCTCTATGGTAGG + Intergenic
966339528 3:178909897-178909919 AAATGACATTTCTCTTGGGTTGG + Intergenic
968884966 4:3323728-3323750 ATGTGAGTTTTCTTTTGGGTAGG + Intronic
969171113 4:5364520-5364542 ATCAGAGTCTTCTCTTGGGTTGG - Intronic
970014532 4:11498742-11498764 AGATGTGTATCCTCTTGGGGTGG + Intergenic
970065864 4:12092647-12092669 AAATGTGTATTCTATTGATTTGG - Intergenic
970107228 4:12598144-12598166 AAATGTATATTCTCTTGTTTGGG - Intergenic
970451733 4:16173949-16173971 AAAAGAGTATTCTCATTGTTAGG + Intronic
971476075 4:27073701-27073723 AAATGTGTATTCTGTTGATTTGG + Intergenic
971729450 4:30358969-30358991 GAATGTATATTCTCTTGGTTTGG + Intergenic
972723387 4:41723232-41723254 AAATGGTTTTTCTCTTGGATAGG + Intergenic
973860405 4:55059020-55059042 AAATGTGTATTCTGTTGATTTGG + Intergenic
975513371 4:75218471-75218493 AAATGTATATTCTCTTGACTTGG + Intergenic
975531485 4:75403738-75403760 AAATGTATATTCTCTTGATTTGG - Intergenic
975535483 4:75445999-75446021 AAATGTATATTCTCTTGATTTGG + Intergenic
976899509 4:90156336-90156358 AAATGTGTATTCTGTTGATTTGG + Intronic
977411791 4:96675236-96675258 AAAAGGGTATTATCTTGGTTGGG - Intergenic
979175615 4:117658951-117658973 AAATGTGTATTCTGTTGATTTGG + Intergenic
980426603 4:132634742-132634764 AAATGTATATTCTCTTGATTTGG + Intergenic
981398785 4:144287293-144287315 AAATTATTATTCTCTTTGGGTGG + Intergenic
981525973 4:145707427-145707449 AACTGAGCAATCTCTTGGGGTGG - Intronic
981871829 4:149496211-149496233 AAATGAGAATTATATTGGGTTGG - Intergenic
981929609 4:150175472-150175494 AAATGGGTATTTCCATGGGTCGG + Intronic
982511428 4:156288051-156288073 AAATGTGTATTCTGTTGATTTGG + Intergenic
982561709 4:156936075-156936097 AAATAAGCACTCTCTTTGGTTGG + Intronic
983447514 4:167873017-167873039 AAATGAGTATTTTCTACTGTGGG - Intergenic
984559115 4:181247635-181247657 AAATGAGAATTCACTTTGGGAGG + Intergenic
984713938 4:182908995-182909017 ATATGTGTATTTTCATGGGTAGG + Intronic
985058416 4:186056132-186056154 AAATGGGTATCCACTTGGGAAGG + Intergenic
986636285 5:9824994-9825016 AAGTCAGTTTTCTGTTGGGTTGG - Intergenic
986716142 5:10524974-10524996 AAGTGAGCATTCTCCTGGGCAGG - Intergenic
989086074 5:37677699-37677721 AAATGTGTATTCTTTTGATTTGG + Intronic
989816725 5:45746531-45746553 AAATGTATATTCTCTTGATTTGG + Intergenic
989820390 5:45788805-45788827 AAATGTATATTCTCTTGATTTGG - Intergenic
989824385 5:45836305-45836327 AAATGTGTATTCTGTTGATTTGG + Intergenic
989950698 5:50293902-50293924 AAATGTGTATTCTGTTGATTTGG + Intergenic
989951975 5:50309866-50309888 AAATGTGTATTCTGTTGATTTGG - Intergenic
990133064 5:52611469-52611491 AAATGTATATTCTCTTGATTTGG + Intergenic
990183466 5:53188521-53188543 AAATGTGTATTCTGTTGATTTGG + Intergenic
990520883 5:56579672-56579694 AAATGACTAATCTCTTGTGGTGG - Intronic
991514099 5:67415027-67415049 AAATGAGTTTTCTCTCAGATGGG + Intergenic
991547325 5:67797047-67797069 AAATGAATACTCTCTTTGCTAGG + Intergenic
993449375 5:88054870-88054892 AAATGTGTATTCTGTTGATTTGG - Intergenic
994249236 5:97517379-97517401 AAATGTGTATTCTGTTGATTTGG + Intergenic
996343365 5:122462865-122462887 AAATAAATTTTCCCTTGGGTAGG - Intronic
996881036 5:128297300-128297322 AAATGTGTATTCTGTTGATTTGG + Intronic
997188364 5:131904348-131904370 GAATGTGTATTCTGTTGGTTTGG - Intronic
997793649 5:136786266-136786288 AAATGTATATTCTCTTGATTTGG + Intergenic
998719814 5:144932135-144932157 AAATGTATATTCTCTTGATTTGG + Intergenic
999114383 5:149149713-149149735 AAAGGAGGATTCTATTAGGTAGG + Intronic
999607105 5:153327869-153327891 AAATGTATATTCTCTTGATTTGG - Intergenic
1000016731 5:157284554-157284576 AAATGAGTATTCTGTTTGCTGGG + Intronic
1000544428 5:162580707-162580729 AAATGAATATTCTGTTGACTTGG - Intergenic
1000593407 5:163185835-163185857 AATTGGGTATACTATTGGGTAGG - Intergenic
1001976243 5:176001947-176001969 GAATGTGTATTCTGTTGTGTTGG - Intronic
1002241179 5:177841824-177841846 GAATGTGTATTCTGTTGTGTTGG + Intergenic
1002717269 5:181235286-181235308 AAATGTCTATTCTCCTGGGGAGG + Exonic
1004974972 6:20955092-20955114 AAATAGGTATTCTCTGAGGTGGG + Intronic
1005026662 6:21468837-21468859 AAATGAATTTGCCCTTGGGTTGG + Intergenic
1008361324 6:50622522-50622544 AAATGTGTATTCTGTTGATTTGG - Intergenic
1009033062 6:58083375-58083397 AAATGTATATTCTGTTGTGTTGG - Intergenic
1009981918 6:70736398-70736420 AAATGTATAATATCTTGGGTGGG - Intronic
1010374510 6:75151067-75151089 AAATAATTATTCTTTTGGGTGGG - Intronic
1010439380 6:75875682-75875704 AGATGTGTATTCCCTTAGGTAGG + Intronic
1011532249 6:88335855-88335877 AAATGTATATTCTGTTGAGTTGG - Intergenic
1012091802 6:94907222-94907244 ATAGGAATATTCTCTTTGGTGGG + Intergenic
1014871083 6:126597292-126597314 AAATGTGTATTCTGTTGATTTGG + Intergenic
1015673067 6:135712651-135712673 AAATGAATTTTCCATTGGGTGGG + Intergenic
1016150425 6:140735006-140735028 ACATGAGTATTCTATTGGCAAGG - Intergenic
1020998032 7:15289831-15289853 AAATGAGTATTCTCTTGGGTAGG + Intronic
1021390876 7:20091135-20091157 AAATGTATATTCTCTTGTTTTGG - Intergenic
1021978612 7:26032693-26032715 AACTGAGTGTTTTCTTGAGTGGG + Intergenic
1022407581 7:30105770-30105792 ATATCATTTTTCTCTTGGGTTGG + Intronic
1024670405 7:51588899-51588921 AAATTAGAATTCTCTTGAGAGGG + Intergenic
1026243760 7:68599815-68599837 CAGTGAGTGTTCTCTTGGCTTGG + Intergenic
1030913583 7:115284024-115284046 AACTGAGTATTCTCTTCTTTGGG - Intergenic
1031439223 7:121772665-121772687 CAATGAGTATACTATTTGGTAGG + Intergenic
1032575605 7:133050642-133050664 AAATGAATATTCTAATGGATAGG + Intronic
1032936620 7:136739918-136739940 AAAAAAATATTATCTTGGGTCGG + Intergenic
1034039860 7:147866382-147866404 AAATGTGTATTCTGTTGATTTGG + Intronic
1034775899 7:153826307-153826329 AAATGTGTGTTCACTTTGGTTGG - Intergenic
1035596321 8:860905-860927 CAATGGGCATTCTCTTGGGTAGG + Intergenic
1038225975 8:25658404-25658426 AAATGTGTATTCTGTTGATTTGG + Intergenic
1038339440 8:26672780-26672802 AAATGAGTATTCTGCTGAGAGGG + Intergenic
1038932691 8:32212883-32212905 AGATGAGTATTTTGTTGGCTTGG + Intronic
1039423269 8:37462912-37462934 AAATGTGTATTCTGTTGATTTGG - Intergenic
1039926774 8:41941057-41941079 CACTGAGTCTTCTCTTGGGAAGG + Exonic
1040754470 8:50755274-50755296 AAATGAGTGGTTTCTTGGGGTGG - Intronic
1041106607 8:54450433-54450455 AAATGGGTATTTACATGGGTAGG - Intergenic
1045409393 8:101902403-101902425 AAATGAATACACTCATGGGTTGG + Intronic
1045830521 8:106454592-106454614 AAATGAAGATGCTGTTGGGTTGG - Intronic
1046322478 8:112596544-112596566 AAATGTGTATTCTGTTGATTTGG - Intronic
1046406750 8:113782645-113782667 AAATGAGGATTATCTTTGATGGG + Intergenic
1046812860 8:118551204-118551226 AAATGTATATTCTCTTGATTTGG - Intronic
1048075588 8:131066498-131066520 AAATGTGTATTCTGTTGATTTGG - Intergenic
1048092197 8:131253000-131253022 AAATGTGTATTCTGTTGATTTGG - Intergenic
1049882754 8:145078396-145078418 AAATGTGTATTCTGTTGATTTGG + Intergenic
1050980348 9:12003925-12003947 AAATGTGTTCTCTCTTGGGTTGG + Intergenic
1051211047 9:14744488-14744510 TAATAAGTATTCTTTTGTGTAGG + Intronic
1053096320 9:35331127-35331149 CAATGAATATTCTCATTGGTTGG - Intronic
1053719577 9:40932047-40932069 AAATGTGTATTCTGTTGATTTGG + Intergenic
1054339571 9:63846103-63846125 AAATGTATATTCTCTTGATTTGG - Intergenic
1058092498 9:100821080-100821102 AAACAAGTCTTTTCTTGGGTAGG - Intergenic
1058230820 9:102421624-102421646 AAATGAGTCTACTTTTGGATGGG - Intergenic
1060070105 9:120539049-120539071 AAAGGAGTATTCTTTTAGTTAGG + Exonic
1185553281 X:1000926-1000948 AAATGCCCATTCTCTTGGCTGGG + Intergenic
1186744771 X:12556302-12556324 AAATGGAGATTATCTTGGGTGGG + Intronic
1187311295 X:18145897-18145919 AAATGTGTCTTTTCTTTGGTAGG - Intergenic
1187602571 X:20848140-20848162 AAATGTGTATTCTGTTGATTTGG - Intergenic
1187874305 X:23791142-23791164 AAATTAGAAATCTCTTGGGCCGG - Intergenic
1188032227 X:25276851-25276873 AAATTAATGTTCTCTTGGATGGG + Intergenic
1190557190 X:51647297-51647319 AAATGTGTATTCTGTTGATTTGG - Intergenic
1190728586 X:53209110-53209132 AAAAGAGGATTCTCTTGGCCAGG - Intronic
1190833072 X:54076565-54076587 AAATGAGGATTTCCTTGGCTAGG + Intronic
1191632224 X:63333925-63333947 GAATGTGTATTCTCTTGATTTGG - Intergenic
1191747002 X:64500676-64500698 AAATGTATATTCTGTTGGTTTGG + Intergenic
1192871230 X:75186485-75186507 AAATGTATATTCTGTTGAGTTGG + Intergenic
1192906607 X:75558624-75558646 AAATGTGTATTCTGTTGATTTGG + Intergenic
1192976401 X:76290535-76290557 AAATGTATATTCTCTTGATTTGG - Intergenic
1193025648 X:76843158-76843180 AAATGTATATTCTCTTGATTTGG - Intergenic
1193189383 X:78551326-78551348 GAATGTGTATTCTCTTGATTTGG - Intergenic
1195692978 X:107644195-107644217 AAATAAGAATTCTCTTTGATTGG + Intronic
1195729002 X:107946901-107946923 GAATGCATATTCTCTTGGTTTGG + Intergenic
1195987201 X:110643481-110643503 AAATGTATATTCTCTTGATTTGG + Intergenic
1196054729 X:111342594-111342616 GAATGTGTATTCTCTTGATTTGG - Intronic
1197083332 X:122444323-122444345 AAATGGATATTCTCTTTTGTTGG - Intergenic
1198454105 X:136798396-136798418 AAATGAAAATTCTCTGGGGGTGG + Intergenic
1198625800 X:138571963-138571985 AAATCAGTATTCTGTTAGGAAGG + Intergenic
1198988241 X:142480384-142480406 AAATGTATATTCTGTTGGTTTGG - Intergenic
1200774415 Y:7157570-7157592 AAATGTGTATTCTGTTGATTTGG + Intergenic
1201626595 Y:16021896-16021918 GAATGTATATTCTCTTGAGTTGG + Intergenic
1201932154 Y:19362231-19362253 GAATGTGTATTCTGTTGGTTTGG - Intergenic