ID: 1021000447

View in Genome Browser
Species Human (GRCh38)
Location 7:15324277-15324299
Sequence GACTTTTAGACGTTGGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021000445_1021000447 12 Left 1021000445 7:15324242-15324264 CCATAGTTGAGACAGAAAACTGC 0: 1
1: 0
2: 0
3: 11
4: 146
Right 1021000447 7:15324277-15324299 GACTTTTAGACGTTGGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021000447 Original CRISPR GACTTTTAGACGTTGGTATC AGG Intronic
No off target data available for this crispr