ID: 1021003258

View in Genome Browser
Species Human (GRCh38)
Location 7:15360329-15360351
Sequence GCAAATTTTTGACCGCACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021003258_1021003262 -2 Left 1021003258 7:15360329-15360351 CCCCCGTGCGGTCAAAAATTTGC No data
Right 1021003262 7:15360350-15360372 GCCTATAACTTTCACCTCCCCGG 0: 1
1: 0
2: 1
3: 35
4: 815

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021003258 Original CRISPR GCAAATTTTTGACCGCACGG GGG (reversed) Intronic